ID: 915121801

View in Genome Browser
Species Human (GRCh38)
Location 1:153634064-153634086
Sequence ACGTGGCGGCCATTTTGTTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 37}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915121794_915121801 26 Left 915121794 1:153634015-153634037 CCTGACGTAATTGCGTAGACGCC 0: 1
1: 0
2: 0
3: 0
4: 8
Right 915121801 1:153634064-153634086 ACGTGGCGGCCATTTTGTTTTGG 0: 1
1: 0
2: 1
3: 3
4: 37
915121796_915121801 5 Left 915121796 1:153634036-153634058 CCATTTTAGCCGGTCAGACAAGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 915121801 1:153634064-153634086 ACGTGGCGGCCATTTTGTTTTGG 0: 1
1: 0
2: 1
3: 3
4: 37
915121798_915121801 -4 Left 915121798 1:153634045-153634067 CCGGTCAGACAAGCACTGGACGT 0: 1
1: 0
2: 1
3: 5
4: 72
Right 915121801 1:153634064-153634086 ACGTGGCGGCCATTTTGTTTTGG 0: 1
1: 0
2: 1
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915121801 Original CRISPR ACGTGGCGGCCATTTTGTTT TGG Exonic
914233201 1:145783973-145783995 ATGTGGCGTCCATATTTTTTGGG - Intronic
915121801 1:153634064-153634086 ACGTGGCGGCCATTTTGTTTTGG + Exonic
915975461 1:160384217-160384239 AGGTGGCTGTGATTTTGTTTGGG + Intergenic
918887602 1:190215727-190215749 AGTTGGCGGCCATCTTGTATTGG - Intronic
923036558 1:230288633-230288655 ACGTGGCCGCCCCTTTGTGTGGG - Intergenic
923404963 1:233650866-233650888 ACGTGGCGTCCATTTTGCCCTGG - Intronic
1066126349 10:32346663-32346685 AGATGGCGGCCATTTTGTGTGGG + Intronic
1075524873 10:123175594-123175616 ACATGGTGGCCATTATCTTTTGG + Intergenic
1097645211 12:62227979-62228001 ATGTGGGTGCCATGTTGTTTTGG + Intronic
1102020385 12:109678224-109678246 ATGTTGCTGCCATGTTGTTTGGG - Intergenic
1116281345 14:42913057-42913079 AAGTGGCTGCTATTTTATTTAGG + Intergenic
1118113123 14:62745289-62745311 ACATGGCTGCCACTATGTTTAGG - Intronic
1119186299 14:72645199-72645221 ACATGGCCACCATTTGGTTTGGG - Intronic
1127124611 15:55799975-55799997 ACATGGCAGCCATTTTGTTTTGG + Intergenic
1131338093 15:91569988-91570010 ACGTGGCGGGCACTTTGCTGAGG - Intergenic
1132335963 15:101048916-101048938 ACGTGGCGGCCATTGAGCTCAGG + Intronic
1143525081 17:7467175-7467197 CAGGGGCGGCCATTTTGTCTAGG - Intronic
941188747 2:162349992-162350014 ACGTGGCAGACATTCTGTTTTGG + Intronic
941251090 2:163163608-163163630 GAGTGACTGCCATTTTGTTTAGG - Intergenic
942745538 2:179227924-179227946 ACCTGGCTGCCATTTGGTATGGG + Intronic
942974423 2:181998082-181998104 ACTGGGAGGCCATTTTGTGTAGG + Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1175060154 20:56234572-56234594 AGGTGGTGGCCATATTGATTTGG - Intergenic
1181833750 22:25584905-25584927 ACGTGGGGGCCATCTCATTTTGG - Intronic
958608182 3:96387447-96387469 ACCTGGAGGCCATTATGCTTAGG - Intergenic
959010589 3:101071003-101071025 AAGTGGAGGCCATTTTGTAGTGG - Intergenic
973838673 4:54838345-54838367 ACATTGAGGGCATTTTGTTTTGG + Intergenic
975736235 4:77383921-77383943 AACTGGCAGTCATTTTGTTTGGG + Intronic
977727407 4:100312229-100312251 CCTTGGCTACCATTTTGTTTTGG + Intergenic
981520758 4:145660082-145660104 ACCTGGAGGACATTATGTTTAGG - Intergenic
983699235 4:170570780-170570802 AAGTTGGGGGCATTTTGTTTTGG + Intergenic
986599866 5:9462124-9462146 ACTTGGTGAACATTTTGTTTAGG - Intronic
995352309 5:111193370-111193392 ATAAGGAGGCCATTTTGTTTTGG - Intergenic
1010398736 6:75424112-75424134 AGGTGCTGGCCATATTGTTTGGG - Intronic
1014400087 6:120977569-120977591 ACGTGGAATACATTTTGTTTTGG + Intergenic
1014861502 6:126473221-126473243 ACATGTAGGCCTTTTTGTTTTGG + Intergenic
1015840770 6:137474600-137474622 CTGTGGCAGTCATTTTGTTTTGG + Intergenic
1018688650 6:166324471-166324493 ACGTGACGAGCATTTTGTTTGGG - Intronic
1026210298 7:68298268-68298290 ATGTGCCAGCCATTTTTTTTTGG + Intergenic
1192330175 X:70169145-70169167 ACGTGGAGGCCAATTAGATTTGG + Intergenic
1194476619 X:94366869-94366891 ACGTGGGGGCCAGTTTTTTGTGG + Intergenic
1199345639 X:146735317-146735339 ACATGGTGTCCATTTTGCTTGGG - Intergenic