ID: 915124515

View in Genome Browser
Species Human (GRCh38)
Location 1:153654313-153654335
Sequence TTGTATGTGCAGTAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915124512_915124515 1 Left 915124512 1:153654289-153654311 CCTGACATACAAACAGCATGGTG No data
Right 915124515 1:153654313-153654335 TTGTATGTGCAGTAGTTGGATGG No data
915124511_915124515 2 Left 915124511 1:153654288-153654310 CCCTGACATACAAACAGCATGGT No data
Right 915124515 1:153654313-153654335 TTGTATGTGCAGTAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915124515 Original CRISPR TTGTATGTGCAGTAGTTGGA TGG Intergenic
No off target data available for this crispr