ID: 915124917

View in Genome Browser
Species Human (GRCh38)
Location 1:153657208-153657230
Sequence GCTACAGTGAGCCAAGATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3010
Summary {0: 1, 1: 26, 2: 223, 3: 969, 4: 1791}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915124917_915124926 29 Left 915124917 1:153657208-153657230 CCACGATCTTGGCTCACTGTAGC 0: 1
1: 26
2: 223
3: 969
4: 1791
Right 915124926 1:153657260-153657282 CTTCAGCCTCCCAAGTAGCGGGG 0: 11
1: 5195
2: 106270
3: 216660
4: 254978
915124917_915124924 27 Left 915124917 1:153657208-153657230 CCACGATCTTGGCTCACTGTAGC 0: 1
1: 26
2: 223
3: 969
4: 1791
Right 915124924 1:153657258-153657280 TACTTCAGCCTCCCAAGTAGCGG 0: 1
1: 63
2: 689
3: 1461
4: 2580
915124917_915124919 -2 Left 915124917 1:153657208-153657230 CCACGATCTTGGCTCACTGTAGC 0: 1
1: 26
2: 223
3: 969
4: 1791
Right 915124919 1:153657229-153657251 GCCTCAACTTCCTAGGCTCAAGG 0: 3
1: 94
2: 573
3: 1786
4: 4157
915124917_915124918 -9 Left 915124917 1:153657208-153657230 CCACGATCTTGGCTCACTGTAGC 0: 1
1: 26
2: 223
3: 969
4: 1791
Right 915124918 1:153657222-153657244 CACTGTAGCCTCAACTTCCTAGG 0: 80
1: 1424
2: 9328
3: 29445
4: 77556
915124917_915124925 28 Left 915124917 1:153657208-153657230 CCACGATCTTGGCTCACTGTAGC 0: 1
1: 26
2: 223
3: 969
4: 1791
Right 915124925 1:153657259-153657281 ACTTCAGCCTCCCAAGTAGCGGG 0: 1288
1: 18606
2: 120851
3: 231375
4: 284961

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915124917 Original CRISPR GCTACAGTGAGCCAAGATCG TGG (reversed) Intergenic
Too many off-targets to display for this crispr