ID: 915125032

View in Genome Browser
Species Human (GRCh38)
Location 1:153657972-153657994
Sequence CAGAAAATGAAAAATTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10629
Summary {0: 1, 1: 7, 2: 88, 3: 1208, 4: 9325}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915125026_915125032 30 Left 915125026 1:153657919-153657941 CCCAGGAGTTCGAGACCAGTCTG 0: 237
1: 5626
2: 29461
3: 35951
4: 25865
Right 915125032 1:153657972-153657994 CAGAAAATGAAAAATTAGTCAGG 0: 1
1: 7
2: 88
3: 1208
4: 9325
915125027_915125032 29 Left 915125027 1:153657920-153657942 CCAGGAGTTCGAGACCAGTCTGG 0: 486
1: 13070
2: 57746
3: 68142
4: 48335
Right 915125032 1:153657972-153657994 CAGAAAATGAAAAATTAGTCAGG 0: 1
1: 7
2: 88
3: 1208
4: 9325
915125030_915125032 15 Left 915125030 1:153657934-153657956 CCAGTCTGGGCAACAAACATAGT 0: 1
1: 2
2: 36
3: 161
4: 2077
Right 915125032 1:153657972-153657994 CAGAAAATGAAAAATTAGTCAGG 0: 1
1: 7
2: 88
3: 1208
4: 9325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915125032 Original CRISPR CAGAAAATGAAAAATTAGTC AGG Intergenic
Too many off-targets to display for this crispr