ID: 915125324

View in Genome Browser
Species Human (GRCh38)
Location 1:153659615-153659637
Sequence CAGTGGCTTTCACTGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915125324_915125328 -2 Left 915125324 1:153659615-153659637 CCTCAACACAGTGAAAGCCACTG 0: 1
1: 0
2: 2
3: 37
4: 277
Right 915125328 1:153659636-153659658 TGTAATTTTAAAATTCTTTGGGG 0: 1
1: 0
2: 12
3: 138
4: 1284
915125324_915125326 -4 Left 915125324 1:153659615-153659637 CCTCAACACAGTGAAAGCCACTG 0: 1
1: 0
2: 2
3: 37
4: 277
Right 915125326 1:153659634-153659656 ACTGTAATTTTAAAATTCTTTGG 0: 1
1: 0
2: 6
3: 70
4: 701
915125324_915125330 4 Left 915125324 1:153659615-153659637 CCTCAACACAGTGAAAGCCACTG 0: 1
1: 0
2: 2
3: 37
4: 277
Right 915125330 1:153659642-153659664 TTTAAAATTCTTTGGGGAAAGGG 0: 1
1: 0
2: 4
3: 145
4: 1661
915125324_915125329 3 Left 915125324 1:153659615-153659637 CCTCAACACAGTGAAAGCCACTG 0: 1
1: 0
2: 2
3: 37
4: 277
Right 915125329 1:153659641-153659663 TTTTAAAATTCTTTGGGGAAAGG 0: 1
1: 1
2: 3
3: 76
4: 841
915125324_915125327 -3 Left 915125324 1:153659615-153659637 CCTCAACACAGTGAAAGCCACTG 0: 1
1: 0
2: 2
3: 37
4: 277
Right 915125327 1:153659635-153659657 CTGTAATTTTAAAATTCTTTGGG 0: 1
1: 0
2: 9
3: 94
4: 991

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915125324 Original CRISPR CAGTGGCTTTCACTGTGTTG AGG (reversed) Intronic
900083670 1:876480-876502 CAGTGGCTCTCACTGTCTGAGGG + Intergenic
902018022 1:13324003-13324025 GAGTGACCTTCCCTGTGTTGAGG + Intergenic
902706029 1:18205211-18205233 CCATGGCTTTCTCTGTGTAGTGG + Intronic
902756458 1:18552479-18552501 GACTGGCTTTCAGTGAGTTGGGG - Intergenic
903574573 1:24330987-24331009 CTGTGCCTTTCACAGTCTTGAGG + Intronic
905091141 1:35432403-35432425 CAATGGCTTCCACTGTGTGCGGG + Intergenic
905234287 1:36535204-36535226 GAGTGGCTTTCTCTGTGCTGTGG + Intergenic
905461877 1:38127474-38127496 TAGTGGCTTTCCCTGCCTTGTGG + Intergenic
907908394 1:58805972-58805994 CTGTGACTTTCAATTTGTTGTGG - Intergenic
908149695 1:61287145-61287167 CAGTGACTATCACAGTGTAGGGG - Intronic
909311327 1:74153776-74153798 CAGTGGCTTTCTATTTGTTTAGG - Intronic
909556665 1:76961453-76961475 CAATGGTTTTCATTGTCTTGGGG + Intronic
910272947 1:85417002-85417024 CAGTGGCTTTTACCGGGTAGTGG + Intronic
910488902 1:87746364-87746386 AAGTGGCTTTCAGTGGGATGGGG - Intergenic
912121543 1:106478306-106478328 CAATGGCTTTTACTATTTTGAGG - Intergenic
912450549 1:109765198-109765220 CTGTGGCCTTCACGGAGTTGGGG - Intronic
912725606 1:112056797-112056819 GAGTGGCTTGGACTGTATTGGGG - Intergenic
912746715 1:112251368-112251390 CAGTGGATTTCCCTGGGTTCAGG - Intergenic
915125324 1:153659615-153659637 CAGTGGCTTTCACTGTGTTGAGG - Intronic
915893041 1:159789114-159789136 CAGTGAATTTCACTGGGGTGGGG - Intergenic
916621001 1:166497132-166497154 ATATGGCTTTCATTGTGTTGAGG - Intergenic
916988654 1:170218540-170218562 AAGTGGGTGTCACTGTATTGGGG + Intergenic
918438236 1:184539140-184539162 ATGTGGCTTTTATTGTGTTGAGG + Intronic
920682294 1:208082452-208082474 CCGTGGATTTCGCTGTGGTGTGG - Exonic
922920236 1:229295731-229295753 CAGTGTCTGTCCCTGTGTTGTGG + Intronic
924175598 1:241388288-241388310 CAGTGACTTTCTCTGTGCTGGGG + Intergenic
1062763569 10:45465-45487 CAGTGGCTCTCACTGTCTGAGGG - Intergenic
1063015746 10:2075341-2075363 CATTGCCTTTCACTGTCTTCAGG - Intergenic
1064926315 10:20573047-20573069 CACTGGCTGACACTGAGTTGAGG + Intergenic
1067365434 10:45623714-45623736 CAGTGACTTTCACATTGTTGGGG - Intronic
1067718266 10:48706052-48706074 CAGTGGCTTTCAGAGTCCTGGGG + Intronic
1067914489 10:50381832-50381854 CAGGGGGTTTAACTGTGGTGTGG + Intronic
1069247684 10:66227322-66227344 ATGTGGCCTTTACTGTGTTGAGG + Intronic
1069920377 10:71812357-71812379 TAGTGCCTTTCACTGACTTGGGG - Intronic
1072171559 10:92867911-92867933 CTGTGCCTTTCACTGTCTTTTGG - Intronic
1072913105 10:99521029-99521051 CGGTGGTTCTCACTGTTTTGTGG - Intergenic
1073187594 10:101625965-101625987 CAGTGGCTTTGGCTGGGGTGGGG + Intronic
1074710054 10:116169698-116169720 AAGTGGCTTTCAGTGGGATGTGG - Intronic
1075551756 10:123397716-123397738 CTGTGTCTTTCACTGTGTCGGGG + Intergenic
1075671939 10:124268897-124268919 GAGTGGCTTTCCCTGAGATGGGG - Intergenic
1076417977 10:130305605-130305627 CAGTGTCTGTCACTGTGTACAGG + Intergenic
1076572131 10:131439801-131439823 CAGTGGCTGTGTCTGGGTTGGGG + Intergenic
1076616340 10:131757592-131757614 CAGTGTCTTTCACTGTCTGTGGG - Intergenic
1078132769 11:8626437-8626459 GAGTGACTTTCACTGAGATGAGG - Intronic
1079316398 11:19411277-19411299 CAGTGGCTTTCAATGGCTTCAGG - Intronic
1080201479 11:29676353-29676375 TAGTGCCTGTCACTGTGTCGAGG - Intergenic
1083426355 11:62589102-62589124 CAGTGGCTTTCCCAGGGATGTGG - Exonic
1084875887 11:72133067-72133089 CTGTGACTTTGAATGTGTTGTGG - Intronic
1085007772 11:73109840-73109862 AAATGGCTTTTATTGTGTTGAGG + Intronic
1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG + Intronic
1086990822 11:93302540-93302562 ATGTGGCTTTCATTGTGTTGAGG - Intergenic
1087071121 11:94081970-94081992 CAGGGTCTTTCCATGTGTTGTGG - Intronic
1088046730 11:105461801-105461823 ATATGGCTTTCATTGTGTTGAGG - Intergenic
1088457126 11:110044502-110044524 CAGTTTCTTTCAGTGTTTTGGGG - Intergenic
1089761739 11:120731207-120731229 GTATGGCTTTTACTGTGTTGAGG + Intronic
1093594930 12:20948649-20948671 GAGGGGCTTTAAGTGTGTTGAGG + Intergenic
1094756042 12:33469751-33469773 GAGTGGCTTTCAGAGTCTTGCGG + Intergenic
1096719554 12:53510952-53510974 TGGTGGTCTTCACTGTGTTGTGG - Intronic
1096729631 12:53597863-53597885 CAGTGGCTTCTACTGGGTAGAGG - Intronic
1098170120 12:67738255-67738277 GACGGGGTTTCACTGTGTTGGGG + Intergenic
1099133789 12:78866697-78866719 CTGTGGATTTCTCTGTGTTCAGG - Intronic
1100151320 12:91741505-91741527 CAGTGGCTTTCATTGTGCTTGGG + Intergenic
1100451769 12:94713405-94713427 CAGCAGCTGTCACTGTGTGGTGG - Intergenic
1101562622 12:105873005-105873027 ATGTGGCTTTTATTGTGTTGAGG - Intergenic
1101745162 12:107535277-107535299 ATATGGCCTTCACTGTGTTGAGG - Intronic
1102922469 12:116802424-116802446 CTGTGACTTTCACTGTACTGTGG + Intronic
1103932881 12:124459892-124459914 TAGTGGCTTTCAGTGTGCAGGGG - Intronic
1105836418 13:24216118-24216140 CAGAGGCTGTCACTGTGCAGAGG + Intronic
1105972979 13:25447810-25447832 AAGTGGCTTTCAGTGGGATGGGG + Intronic
1106879933 13:34117911-34117933 CTTTGGTTTTCACTGTGATGAGG - Intergenic
1107582679 13:41808201-41808223 ATATGGCTTTCATTGTGTTGAGG - Intronic
1108439296 13:50433529-50433551 CAGTGGGCTTTACTGTGTTGAGG + Intronic
1109119247 13:58433316-58433338 CATTGGCTTTCAATGTGGGGAGG - Intergenic
1109475951 13:62880565-62880587 ATATGGCTTTCATTGTGTTGAGG - Intergenic
1111091543 13:83453268-83453290 CATTCGCTTTCACTGTTTGGTGG - Intergenic
1111574411 13:90132842-90132864 AAATGGTTTTCATTGTGTTGAGG + Intergenic
1111627970 13:90813602-90813624 CAGTGGCTTTGCCAGTGCTGTGG - Intergenic
1115379776 14:32722736-32722758 AAGTGGCTCTCACTGGGATGGGG - Intronic
1116054555 14:39847372-39847394 CATGGGCTTTTACTGTGTTTGGG - Intergenic
1116682172 14:47985868-47985890 ACATGGCTTTTACTGTGTTGAGG - Intergenic
1117136403 14:52738571-52738593 CAGTGGCTTTGAGTGTCTTTTGG + Intronic
1120604289 14:86553610-86553632 CTGTGGCATTCACTGTAGTGTGG + Intergenic
1122892630 14:104739916-104739938 CAGGGGCTTTGAGTGGGTTGAGG - Intronic
1124451240 15:29793247-29793269 CTGTGGCTTTTATTGTGTTGAGG + Intronic
1124471078 15:29986612-29986634 CTGTGTCTTTCTTTGTGTTGTGG - Intergenic
1124647693 15:31450526-31450548 AATTGGCTTGCACTGTTTTGGGG + Intergenic
1127173939 15:56333521-56333543 CTATGGCTTTTATTGTGTTGAGG - Intronic
1127923741 15:63517554-63517576 CAGTGGGCTTCACTGTGAGGTGG + Intronic
1129092901 15:73170515-73170537 CAGGAGCTTTCACTGTGTTCAGG + Intronic
1129278317 15:74462200-74462222 AAATGGCTTTCACTGTCTTCAGG + Intergenic
1130366066 15:83240378-83240400 ACGTGGCTTTTATTGTGTTGAGG - Intergenic
1130419025 15:83723756-83723778 CAGTGGTTATCACTGGGTTGTGG + Intronic
1130440750 15:83951160-83951182 ACATGGCTTTCATTGTGTTGAGG + Intronic
1130543032 15:84835512-84835534 CAGTGCCTGACACTGTGGTGTGG - Intronic
1130702825 15:86202618-86202640 CAGAAGCTTTCATTATGTTGGGG + Intronic
1130980948 15:88811580-88811602 CAGTGGAGTTCACTGTGGGGTGG + Intronic
1131346779 15:91656669-91656691 CAGTGGCTTTCCCTTAGCTGGGG - Intergenic
1132846967 16:2005138-2005160 CAGGGCCTTTCCCTGTGTTTGGG - Intronic
1133918053 16:10126982-10127004 CATTGGCTTTCACTGGCTTAGGG - Intronic
1134093057 16:11401836-11401858 CCGTGGCTGTCAAGGTGTTGTGG + Intronic
1134487796 16:14672368-14672390 CTGTGTTTATCACTGTGTTGGGG - Intergenic
1134510015 16:14838675-14838697 CAGTGGCTCTCTCTGTGTTTAGG + Intronic
1134697664 16:16237169-16237191 CAGTGGCTCTCTCTGTGTTTAGG + Intronic
1134822420 16:17257440-17257462 CAGTGGTTTTCTCTGTGGAGAGG - Intronic
1134974180 16:18557501-18557523 CAGTGGCTCTCTCTGTGTTTAGG - Intronic
1135830932 16:25772537-25772559 CAGTGTGTTTCAGTGTGTTTAGG + Intronic
1137044237 16:35641430-35641452 CAGTGAATTTCACTGTTTTGTGG + Intergenic
1137508385 16:49076576-49076598 CAGTCACTTGCTCTGTGTTGGGG + Intergenic
1137581264 16:49634856-49634878 AAGTGGCTTTCAATGAGCTGGGG - Intronic
1137628967 16:49928595-49928617 CGTTGGCTTTCCATGTGTTGTGG - Intergenic
1138776823 16:59733420-59733442 CAGTGGCTTTTATTATTTTGAGG - Intronic
1139508289 16:67410533-67410555 CAATGGCTTTCACCTTGTGGGGG - Intronic
1140119446 16:72070946-72070968 CAGTGGCTTACAGTTTGGTGGGG - Intronic
1140737754 16:77913458-77913480 CACTGGATTTAACTTTGTTGGGG - Intronic
1142318483 16:89365400-89365422 CAGTGGCTCTCACTCTTGTGTGG - Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1147335314 17:39723949-39723971 CAGTGGCCATCAAAGTGTTGAGG + Exonic
1148854469 17:50571112-50571134 CAGTGGCTTTCCCTATGGAGGGG + Intronic
1150227414 17:63531487-63531509 CTGGGGCTGTCCCTGTGTTGGGG + Intronic
1150449525 17:65254940-65254962 CAGTGGTTATCTCTGTGTGGTGG - Intergenic
1150606957 17:66700301-66700323 AAATGGCTATTACTGTGTTGAGG - Intronic
1151527948 17:74683833-74683855 CAGTGGCATTCACTGTCGAGGGG + Intronic
1151704925 17:75762419-75762441 CAGTGGCTATCTCTGGGTAGTGG + Intronic
1152326228 17:79639836-79639858 TATGGGCTTTTACTGTGTTGAGG - Intergenic
1152496802 17:80678905-80678927 CAGTGGCTTTCACTGCTGTGTGG + Intronic
1152956478 18:45796-45818 CAGTGGCTCTCACTGTCTGAGGG - Intergenic
1154448866 18:14458971-14458993 CGGTGGCTTGCACAGGGTTGGGG - Intergenic
1154960520 18:21303907-21303929 CAGAAGCTGACACTGTGTTGGGG + Intronic
1159168375 18:64730903-64730925 CAGGGGCTTTCATTGTCATGAGG - Intergenic
1160627962 18:80225939-80225961 CAGTGGTTTTCTTTGTGGTGGGG - Intronic
1162514458 19:11139508-11139530 CAGTGGCCTCCACTGGGGTGTGG + Intronic
1167048893 19:47067099-47067121 CGGTGGCATTGACTGTCTTGAGG + Exonic
1167057824 19:47123792-47123814 CAGTAGCTTGCCCTGTGTTTAGG + Intronic
925024789 2:599183-599205 CAGTGGTTTTCTCTGTGACGGGG + Intergenic
926819901 2:16840535-16840557 CATTTTCTTTCACTGAGTTGGGG + Intergenic
927800080 2:26090743-26090765 GAGGGGGTTTCACTATGTTGGGG - Intronic
928484525 2:31716893-31716915 CTATGGCTTTTATTGTGTTGAGG - Intergenic
929931523 2:46259928-46259950 CATTGGCTATCACTGGGTTGTGG - Intergenic
930197979 2:48528510-48528532 CAGTGCCTTTTTCTGTGTTTAGG + Intergenic
931036170 2:58245425-58245447 CAGTGGCTTTCACTGGGTGTGGG - Intergenic
932291658 2:70585344-70585366 TAGTGGTTATCACTGGGTTGTGG - Intergenic
935478275 2:103552793-103552815 ATATGGCTTTCATTGTGTTGAGG + Intergenic
935958177 2:108399259-108399281 AAGTGGCTTTCAGTGGGATGGGG - Intergenic
936542271 2:113362029-113362051 CAGTGTCTTTCATGGTCTTGAGG - Intergenic
936975223 2:118213157-118213179 CAGTTGTTTTAAATGTGTTGAGG - Intergenic
937649394 2:124303100-124303122 CACCAGCTTCCACTGTGTTGTGG + Intronic
937739840 2:125337917-125337939 ATATGGCTTTTACTGTGTTGAGG - Intergenic
938665459 2:133530830-133530852 CAGTGGCTGTCACCCTCTTGTGG - Intronic
939810765 2:146829446-146829468 CATTGTCTTTCACTGAGGTGGGG - Intergenic
940444332 2:153759447-153759469 GCATGGCTTTCATTGTGTTGAGG + Intergenic
940716964 2:157237118-157237140 AAATGGCTCTCAGTGTGTTGGGG - Intergenic
940979318 2:159983620-159983642 CAATGGTTTTCAAAGTGTTGTGG - Intronic
943069375 2:183122813-183122835 AAGTGGATTGCCCTGTGTTGTGG + Intronic
944498216 2:200329879-200329901 AAGTGGCTATCACTGTGAGGAGG - Intronic
944955694 2:204805910-204805932 ATGTGGCTTTTATTGTGTTGAGG - Intronic
946513076 2:220381302-220381324 ATGTGGCTTTTACTGTGTTGTGG + Intergenic
946727977 2:222680882-222680904 CAGTGGCTTTCACAATGTTTTGG + Intronic
949035463 2:241814006-241814028 CTGTGGCTTCCACGGTGCTGTGG + Intronic
1170314226 20:15025855-15025877 GAGTGGCTCTCAATGGGTTGAGG - Intronic
1171086273 20:22240825-22240847 CAGTGGCTTTCTCTCTGATGTGG - Intergenic
1171516464 20:25742126-25742148 CAGTCACTATCAGTGTGTTGAGG + Intergenic
1173744502 20:45426177-45426199 CAGTGTATGTCACTGTGTAGTGG + Exonic
1174939364 20:54907644-54907666 AAATGGCTTTTATTGTGTTGAGG - Intergenic
1175520210 20:59597993-59598015 CAGTATCTGTCACTGTGTGGGGG + Intronic
1176981530 21:15386807-15386829 AAGTGGCTTTCAGTGGGATGGGG - Intergenic
1177090537 21:16761773-16761795 ATGTGGCTTTTATTGTGTTGAGG - Intergenic
1177352541 21:19962726-19962748 CAGCTACTCTCACTGTGTTGTGG + Intergenic
1180486859 22:15809077-15809099 ATATGGCTTTTACTGTGTTGAGG + Intergenic
1182037256 22:27208790-27208812 CAGTGGTTATCGCTGAGTTGTGG + Intergenic
1182453526 22:30435189-30435211 CAGTGTCTCTCACTGTGAAGGGG - Intergenic
1182462046 22:30490098-30490120 CTGGGGTCTTCACTGTGTTGGGG + Exonic
1183884915 22:40871594-40871616 CAGTGGCTTTCTCTGAGTTGTGG - Intronic
950432290 3:12957795-12957817 TAGTGGCTGTGCCTGTGTTGGGG - Intronic
950662696 3:14476564-14476586 CAGTGGCTTTCAATCCTTTGGGG - Intronic
951941957 3:28088988-28089010 CTCTGGTTTTCACCGTGTTGGGG - Intergenic
953356401 3:42259901-42259923 CAATGACTCCCACTGTGTTGGGG + Intronic
953670880 3:44961048-44961070 CAGTCACTATCACTGTGTTAGGG + Intronic
954032419 3:47829139-47829161 CAGTGGCTTTCACTGAGGAAGGG - Intronic
954570125 3:51633639-51633661 CAGTGGCTTTGGCTGTATTCTGG + Exonic
959845761 3:111031530-111031552 CAATGGCTTTCAAAGAGTTGGGG - Intergenic
960598114 3:119425725-119425747 ATGTGGCCTTCACTGTATTGAGG + Intergenic
961312010 3:126008403-126008425 GTGTGGGTTGCACTGTGTTGTGG + Intronic
961429122 3:126867915-126867937 CAGTGGCTCTCACTGCATTCAGG + Intronic
961907173 3:130275093-130275115 CAGTTGCTTGTACTGTGTTAAGG - Intergenic
962169636 3:133087441-133087463 CAGTGGTTTCCACTGGCTTGGGG + Intronic
962449311 3:135498660-135498682 CAGTGACTGTCATTGTGTTAGGG + Intergenic
962458000 3:135582954-135582976 CAGTGGCTTTCTCTGCCTTTAGG + Intergenic
962712180 3:138097454-138097476 CAGTGGCCTTCACTGTGAATGGG - Intronic
963245276 3:143052615-143052637 GGGTGGCTTTCACTCTGCTGTGG + Intronic
964140714 3:153396342-153396364 AAGTCTCTTTCTCTGTGTTGAGG + Intergenic
964266989 3:154909509-154909531 ATGTAGCTTTTACTGTGTTGAGG - Intergenic
964687187 3:159409135-159409157 ATGTGGCTTTTATTGTGTTGAGG - Intronic
964884376 3:161464558-161464580 CATTAGCTTTCTCTGTATTGGGG + Intergenic
965144773 3:164887591-164887613 AAGTGGCTTTTATTGTGTTGAGG + Intergenic
965284971 3:166806909-166806931 ATGTGGCTTTTATTGTGTTGAGG - Intergenic
967460839 3:189744240-189744262 CAGCTGCTGTCACTGTGGTGGGG + Intronic
967506582 3:190259504-190259526 CAGTGGGTTTCACTGTTCTGTGG + Intergenic
968357857 3:198122450-198122472 CAGTGGCTCTCACTGTCTGAGGG + Intergenic
971787501 4:31123795-31123817 AAGTGGCTCTCAGTGTGATGGGG + Intronic
973663224 4:53129948-53129970 CAGTGGTTTTCTCTGGGTAGTGG + Intronic
977422620 4:96821963-96821985 CAGTGGGTGGCACTGTGCTGAGG - Intergenic
978097872 4:104801832-104801854 ATGTGGCCTTTACTGTGTTGAGG - Intergenic
978364190 4:107963515-107963537 ATATGGCTTTTACTGTGTTGAGG - Intergenic
978424654 4:108569572-108569594 CAGTGGTTTTCAGTGGGTAGAGG + Intergenic
978753694 4:112281459-112281481 CAGTGGCTATGAGTGTCTTGGGG + Intronic
980636870 4:135517626-135517648 AGATTGCTTTCACTGTGTTGAGG - Intergenic
981020860 4:140026658-140026680 CAGTGGCTGTCTTTGTGTAGGGG - Intronic
983064337 4:163191759-163191781 GAGGGGCTTTAAGTGTGTTGAGG + Intergenic
985713773 5:1444914-1444936 CGGGGGCTTTGTCTGTGTTGGGG - Intronic
985947213 5:3195176-3195198 TAGTGACCTTCACTGTGTGGAGG + Intergenic
986187464 5:5458378-5458400 CAGTGGGCTTCATTGTGTGGAGG + Intronic
986757312 5:10850218-10850240 CAGTGGTTTTCTCTTTGCTGAGG - Intergenic
990173217 5:53078353-53078375 CAGGGGTTTTCACTTTGGTGTGG - Intronic
991095350 5:62733973-62733995 GAGTGGCTTTCATTGTATTTGGG - Intergenic
991239093 5:64436519-64436541 ATATGGCTTTTACTGTGTTGAGG - Intergenic
992113504 5:73517692-73517714 CAGAGGCTATCTCTGGGTTGTGG + Intergenic
992185635 5:74241834-74241856 CAGTGGTTCTCAGTGTGCTGTGG + Intergenic
994265269 5:97708525-97708547 ATATGGCTTTCACTATGTTGAGG - Intergenic
995371272 5:111421464-111421486 TACTGGCATTCACGGTGTTGGGG - Intronic
996890328 5:128411410-128411432 AAGTGGCTTTCAGTGGGATGGGG + Intronic
997714443 5:136031469-136031491 CAGTAGATCTCACTGTGTTGTGG - Intronic
998645798 5:144060522-144060544 CAGGGCCTGTCAGTGTGTTGGGG + Intergenic
998938149 5:147252677-147252699 CAGTGGTTATCACTGGGCTGAGG - Intronic
999061527 5:148640553-148640575 CACTGGCATTCCCTGTGTTGTGG - Intronic
1000201814 5:159018280-159018302 CAGTGGCTTCAACTATGATGTGG + Intronic
1002701740 5:181129714-181129736 CAGTGGCTTCTTCTATGTTGTGG - Intergenic
1003430607 6:6033864-6033886 CAGTTACATTCACTGTGATGTGG - Intergenic
1006718507 6:36135428-36135450 CTGTGGCTTTCCCTGGGGTGTGG + Intronic
1006770954 6:36552221-36552243 CAGTGGCTTTCTCTGAGTGGAGG + Intergenic
1007265943 6:40595947-40595969 CTGTGGTTTTCATTATGTTGTGG + Intergenic
1007634231 6:43288170-43288192 CAGTGGCTTCCAGGGTGTTGGGG - Exonic
1009267740 6:61577017-61577039 CAGTCTCTTTTACTGTATTGTGG + Intergenic
1009802073 6:68551431-68551453 CTCTAGCTTTCATTGTGTTGGGG - Intergenic
1009845257 6:69126412-69126434 CAGTGGCTTCCACAGTTCTGAGG - Intronic
1011404552 6:87004592-87004614 ATGTGGCTTTTATTGTGTTGAGG - Intronic
1012927490 6:105282193-105282215 CACTTGCTTTCACAGTGATGAGG + Intronic
1012987739 6:105893020-105893042 CAGTGGCTGTGCCTGTGGTGAGG - Intergenic
1014812409 6:125901834-125901856 AAGTGGCTTTCAGTGGGATGGGG + Intronic
1017339057 6:153299445-153299467 TAGTGTCATTCACTGTGTTCAGG - Intergenic
1017766251 6:157609652-157609674 GAGTGTCTTTCCCTGTCTTGTGG + Intronic
1018462849 6:164015566-164015588 CCTTGTCTTGCACTGTGTTGGGG + Intergenic
1018555773 6:165049444-165049466 GAGTGACACTCACTGTGTTGGGG - Intergenic
1018786566 6:167112949-167112971 CAATCAGTTTCACTGTGTTGTGG + Intergenic
1019149922 6:169998462-169998484 CAGGGCCTTGTACTGTGTTGGGG + Intergenic
1020799914 7:12720666-12720688 GATGGGGTTTCACTGTGTTGAGG - Intergenic
1021073592 7:16273560-16273582 AAGTGGCTTTCAGTGGGATGCGG - Intronic
1021376163 7:19909447-19909469 ATATGGCTTTTACTGTGTTGAGG - Intergenic
1022860754 7:34364121-34364143 GAGTGGCTTTCCCTGTGTTAGGG + Intergenic
1023040835 7:36172062-36172084 CAGTGTATTTCACTTTCTTGGGG + Intronic
1028980838 7:96966675-96966697 CAGTGGCCTTCACTGTCTGGAGG + Intergenic
1029032178 7:97480080-97480102 CAGTTGCTTTCACTTGGCTGTGG + Intergenic
1029504913 7:100957416-100957438 CTGTGGCTGTTACTGTGGTGAGG - Exonic
1031300967 7:120060380-120060402 CTGTGGCTTTCCCTTTGTTTTGG + Intergenic
1031411961 7:121450013-121450035 CAATTGCCTTCACTTTGTTGTGG - Intergenic
1031784250 7:126008909-126008931 CAGGGCCTGTCAGTGTGTTGGGG - Intergenic
1031909387 7:127498981-127499003 CAGTCACCTTCACTGTCTTGGGG - Intergenic
1032814014 7:135452597-135452619 CAGTGTCTGTCACTGAGTAGAGG + Intronic
1033813897 7:145049902-145049924 ATGTGGCTTTTATTGTGTTGAGG + Intergenic
1034072754 7:148202798-148202820 CAGAGGCTCTCACTGTGCTGGGG + Intronic
1034373736 7:150625812-150625834 CAGTGGCTTTGACTATAATGTGG - Exonic
1034559023 7:151867892-151867914 CAGTGACCTCCACTGTGCTGGGG - Intronic
1035127793 7:156621765-156621787 CTATGGCTTTTATTGTGTTGAGG - Intergenic
1035325803 7:158065151-158065173 CAGTGGCTCTGACTGTCTGGTGG + Intronic
1037282839 8:17262439-17262461 CAGTGGCTCTGAATTTGTTGGGG - Intronic
1038014212 8:23499558-23499580 CAGAGGCCTTCACTGATTTGAGG - Intergenic
1038169358 8:25114854-25114876 CAGTGGGAATCACTGTGCTGTGG + Intergenic
1038855001 8:31321321-31321343 CAGTGGCCTTCACTGGGTTGTGG + Intergenic
1039290439 8:36088850-36088872 AAGTGGCTCTCAGTGTGATGGGG + Intergenic
1041146969 8:54886872-54886894 CATTGGTATTCATTGTGTTGTGG + Intergenic
1042298372 8:67247562-67247584 ATATGGCTTTCATTGTGTTGAGG - Intronic
1043782532 8:84354175-84354197 GGGTGGCTTTCACTGAGTTGAGG - Intronic
1044394802 8:91698522-91698544 CTATGGCTTTTATTGTGTTGAGG + Intergenic
1044519283 8:93178938-93178960 CAGTGGCTTCCACTGTATTTGGG - Intergenic
1045519041 8:102887209-102887231 CAGTGTGCTTCTCTGTGTTGGGG - Intronic
1045566763 8:103324984-103325006 CAATGGCTGGCACTGTGTGGTGG + Exonic
1046150328 8:110215650-110215672 ATGTGGCTTTTACTATGTTGAGG - Intergenic
1046311720 8:112445703-112445725 CAGTGTATTTCTCTGTGTTGTGG - Intronic
1047780016 8:128103443-128103465 AAGGGGCTTACACTGTGTCGGGG - Intergenic
1048190244 8:132281795-132281817 CAGTGGCTTTCACTGCCTACGGG + Intronic
1049030745 8:140035719-140035741 CAGTGGCCTTCAGTGTGGTTAGG - Intronic
1051294187 9:15577511-15577533 AAGAGGCTTTCACTGTGTTCAGG + Intronic
1052455472 9:28691404-28691426 CAAGTGCATTCACTGTGTTGTGG - Intergenic
1052471653 9:28904213-28904235 ATGTGGCTTTTATTGTGTTGAGG - Intergenic
1054752733 9:68924879-68924901 CAGTGGATATCTCTGGGTTGTGG - Intronic
1055107720 9:72529692-72529714 CAGTGGTTTTCACTGCCTTTGGG + Intronic
1056540267 9:87564991-87565013 AAGTGGGTTTCACTGTGTCTGGG + Intronic
1056634849 9:88323092-88323114 CTGTGGCTTCCTCTGAGTTGTGG - Intergenic
1057288002 9:93776113-93776135 CAGTGTCTTTCACAGAGTAGTGG - Intergenic
1057735779 9:97658426-97658448 CACTGGCTTGCACTGAGGTGCGG - Intronic
1059112360 9:111569443-111569465 CAGTGGATTTCACTATGTAAGGG + Intronic
1059290658 9:113221246-113221268 CGTTGGCTTTCACCGGGTTGCGG + Exonic
1059838102 9:118179922-118179944 CAATGGTTTTCTCTGTGTTATGG - Intergenic
1060920703 9:127418403-127418425 CAATCACTTTCACTCTGTTGGGG - Intergenic
1061689590 9:132315331-132315353 CAGTTGCTTTGTCTGTTTTGGGG - Intronic
1061956382 9:133963521-133963543 GGGTGGCTATCCCTGTGTTGGGG + Intronic
1062036475 9:134384797-134384819 CAGTGGGTTTCCCTGTGCTCAGG + Intronic
1062181533 9:135193690-135193712 CAGTCCCTGTCACTGTGGTGGGG - Intergenic
1062303235 9:135887609-135887631 CAGTGTCTTTCACTGGGTCAGGG + Intronic
1186793392 X:13020827-13020849 TAGTGGCTTTCAATGCCTTGGGG + Intergenic
1187045281 X:15642070-15642092 CAGTGGGTTTCATTATTTTGTGG - Intronic
1188236783 X:27741304-27741326 CAGTGGCTCTGACTCTGTTGGGG - Intronic
1188668570 X:32855172-32855194 ATGTGGCTTTTACTGTGTTAAGG - Intronic
1188968253 X:36580980-36581002 CAGTGGCATCAAATGTGTTGGGG + Intergenic
1191997281 X:67109057-67109079 CTGTTACTTTCACTGTGTAGAGG + Intergenic
1193742667 X:85236686-85236708 GTGTGACTTTTACTGTGTTGTGG - Intergenic
1193921958 X:87439023-87439045 CAATGGCTTTTATTATGTTGAGG + Intergenic
1197670186 X:129268449-129268471 ATATGGCTTTCATTGTGTTGAGG + Intergenic
1198595366 X:138230107-138230129 CAGTGGCTTTCTCTCTATTCCGG + Intergenic
1199646000 X:149912562-149912584 ACGTGGCTTTTATTGTGTTGAGG - Intergenic
1200182452 X:154159041-154159063 CAGAGGCTTTCACTGCAGTGTGG + Intergenic
1200188106 X:154196155-154196177 CAGAGGCTTTCACTGCAGTGTGG + Intergenic
1200193756 X:154233295-154233317 CAGAGGCTTTCACTGCAGTGTGG + Intergenic
1200199511 X:154271099-154271121 CAGAGGCTTTCACTGCAGTGTGG + Exonic
1200383562 X:155865554-155865576 CACTGGCAGTCACTGTGCTGCGG - Intergenic
1201742337 Y:17337312-17337334 GATGGGGTTTCACTGTGTTGAGG + Intergenic
1202297712 Y:23377262-23377284 CAGTGGCTTTCAAATTGTTTTGG - Intergenic
1202573097 Y:26293335-26293357 CAGTGGCTTTCAAATTGTTTTGG + Intergenic