ID: 915125555

View in Genome Browser
Species Human (GRCh38)
Location 1:153661118-153661140
Sequence AACTAGGTGCTGAAAAATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915125555_915125557 6 Left 915125555 1:153661118-153661140 CCGGTATTTTTCAGCACCTAGTT 0: 1
1: 0
2: 2
3: 19
4: 160
Right 915125557 1:153661147-153661169 CACTCTCAAGCCTTTCACAGTGG 0: 1
1: 0
2: 2
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915125555 Original CRISPR AACTAGGTGCTGAAAAATAC CGG (reversed) Intronic
901914767 1:12490083-12490105 CACTAGGTCCTGAAGAAGACTGG - Intronic
902032018 1:13430108-13430130 AACAAGGAGGTTAAAAATACAGG - Intergenic
904798815 1:33078533-33078555 TACTAGGTGATGAAAAAAGCTGG + Intronic
909158890 1:72118668-72118690 AACTGGGTACTTAAAAGTACTGG - Intronic
909602253 1:77472825-77472847 AACTAGAATCTGAAAAAGACAGG - Intronic
909680593 1:78287246-78287268 AAAAAAGTGCTTAAAAATACTGG - Intergenic
910148770 1:84115562-84115584 AACTAAGACCTCAAAAATACAGG - Intronic
911979916 1:104554311-104554333 AACTAGGTGTTGAAAAAAATAGG + Intergenic
915125555 1:153661118-153661140 AACTAGGTGCTGAAAAATACCGG - Intronic
916226158 1:162491449-162491471 AAGTAGGTGCTTAATGATACAGG - Intergenic
916522003 1:165571956-165571978 AATTAGGTGTTCAAAAAAACTGG + Intergenic
916934819 1:169616822-169616844 AACTAGCTGCTTAAAACTAGAGG - Intronic
917526520 1:175793065-175793087 AGTTAGGTCATGAAAAATACAGG + Intergenic
919370350 1:196716652-196716674 ATTTAGGTGATGAAAAGTACAGG + Intronic
921353422 1:214261444-214261466 ATGTAGGGGCTGAAAAACACAGG + Intergenic
923225483 1:231935249-231935271 AAATCCGTGCTGAAAAATGCGGG - Intronic
1063927544 10:10995357-10995379 AAATAGGTGCTCAAAAATACTGG - Intergenic
1065034410 10:21622878-21622900 AACCAGTTGGTGAAAAGTACAGG - Intronic
1067956492 10:50796680-50796702 AAGTAGGTGTTTAAAAATGCTGG - Intronic
1068711300 10:60137521-60137543 AACAATGTGCTTAAAAATATTGG + Intronic
1069025406 10:63534718-63534740 AACTAGGATCAGAAAAATATAGG + Intronic
1070049577 10:72874641-72874663 AACTAGGTGCTAAAAATTCTGGG - Intronic
1072471480 10:95717956-95717978 AACAAGGAGCTTAAACATACAGG + Intronic
1072968621 10:99997036-99997058 ATATAGCTGCTCAAAAATACGGG + Intronic
1077631791 11:3816233-3816255 CACTCGGTGCTGAAGAATCCGGG - Intronic
1079345296 11:19646527-19646549 TACCAGGTGCTGAAAACTACTGG + Intronic
1082647445 11:55745856-55745878 AACTAGGTTCTGATAAAAACAGG + Intergenic
1083805191 11:65069291-65069313 CACAAGATTCTGAAAAATACCGG - Intronic
1086050685 11:82586718-82586740 TACTAGGTGCTGGGGAATACAGG + Intergenic
1086076571 11:82860049-82860071 ACCTAGTAGCTGATAAATACTGG - Exonic
1087025179 11:93642519-93642541 AGCTGGGTGCTCATAAATACAGG + Intergenic
1087075620 11:94125006-94125028 AACAAGGAGTTTAAAAATACAGG - Intergenic
1087796413 11:102459036-102459058 AAGTAGGAGCTGATAAATAACGG - Intronic
1089264589 11:117250208-117250230 AACTGAGTCCTGAAAAATAAGGG + Intronic
1090784314 11:130035742-130035764 AGGCAGATGCTGAAAAATACAGG + Intergenic
1091012396 11:132015115-132015137 TAATTGGTGCTGAAAAAAACTGG - Intronic
1097282979 12:57856710-57856732 AATTAGAAGCTGAAAAATAAAGG - Intergenic
1098790770 12:74818987-74819009 AATTAGATGCTGGACAATACTGG - Intergenic
1100179469 12:92069759-92069781 AACTAGGTGAGAAAAATTACTGG + Intronic
1105340073 13:19514337-19514359 ATCTAAGTGGTGAAAAATACTGG - Intronic
1106763278 13:32889418-32889440 AAATAGTTGTTGAAAAATAGAGG + Intergenic
1107137312 13:36958370-36958392 AACAAGGAGGTTAAAAATACAGG - Intronic
1107215095 13:37907566-37907588 ATTTAGGAGTTGAAAAATACGGG + Intergenic
1107661911 13:42647570-42647592 AAATAGGTACTGAAAAATGGTGG - Intergenic
1108634632 13:52320515-52320537 ATCTAAGTGGTGAAAAATGCTGG - Intergenic
1111633070 13:90867754-90867776 ATGGAGGTGCTGAATAATACAGG - Intergenic
1112659077 13:101486536-101486558 AAATAAGTGATGAAAGATACTGG + Intronic
1115731853 14:36277996-36278018 TATTAGGTGCTGAAAAACAAGGG + Intergenic
1117207768 14:53462186-53462208 AACGAGGTGCTTATAAATACTGG + Intergenic
1117962328 14:61175822-61175844 AACTAGGTGGTGAAAAATAAGGG - Intergenic
1119489637 14:75019944-75019966 ATATAGGTGCTATAAAATACAGG + Intronic
1124133290 15:27009518-27009540 TATTAGAAGCTGAAAAATACTGG - Intronic
1124967926 15:34451951-34451973 AAATAGGCTCTCAAAAATACAGG + Intergenic
1125050911 15:35297218-35297240 GACAAGGGGCTAAAAAATACTGG - Intronic
1126721048 15:51580214-51580236 AACTAGATTCTGAAAAAGAATGG - Intronic
1127704280 15:61531747-61531769 ACCTAGTTGCTGAAAAATGATGG - Intergenic
1131043122 15:89291326-89291348 AACTTGGAGGTTAAAAATACAGG - Intronic
1131108086 15:89748035-89748057 ACCTAGGTGCTAATAAACACTGG + Intergenic
1131797303 15:96032315-96032337 AACTATTTCCTGAATAATACTGG - Intergenic
1133009650 16:2904141-2904163 AACCAGGTGTTGACAAATGCCGG - Intergenic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1138902063 16:61284776-61284798 TACTAGCTGCTCAAAAATACTGG + Intergenic
1140838407 16:78816857-78816879 AACCAGGTGATGAAAAATTTTGG - Intronic
1140975711 16:80058215-80058237 AATGAAGTGCTGAAAAATGCAGG - Intergenic
1141871926 16:86792835-86792857 AACTAGGAGCTGAAATACACAGG + Intergenic
1143630108 17:8134036-8134058 AAATATGTGCTGAAGAATAAAGG - Intergenic
1144335175 17:14262229-14262251 AGCTTGGTGGTGAAAATTACAGG - Intergenic
1146144862 17:30405492-30405514 AACTAGGTGGCAAAAAATACTGG - Intronic
1146473817 17:33145752-33145774 GAATAGGTGCTTAAAAATGCTGG + Intronic
1155268269 18:24115008-24115030 AGCTAGTTGGTGAAAAACACTGG - Intronic
1155818209 18:30343113-30343135 AACTAGGTGGGGAAAAAGGCAGG + Intergenic
1157679720 18:49595285-49595307 AACTAGGTGCTTAAACAGGCAGG + Exonic
1159166656 18:64710882-64710904 AACTAGAAGATGAAAAATAATGG - Intergenic
1166629523 19:44393054-44393076 AACTAGGTATTAAAAAATAGTGG + Intronic
925310722 2:2879569-2879591 AACTAGGTGGTGAGAGGTACAGG + Intergenic
928354293 2:30595555-30595577 AGCTAGGTGCTGAAGGATACTGG - Intronic
929385165 2:41398116-41398138 AAATATCTGCTGAAAAATGCAGG - Intergenic
929759305 2:44793269-44793291 CACTAGATGCTGGAAAATAATGG + Intergenic
930977726 2:57484476-57484498 ACCAAGGAGATGAAAAATACAGG - Intergenic
931760500 2:65412645-65412667 AACTGGTTGCTGAAAAACAAAGG - Intronic
935366422 2:102296265-102296287 AACTAGTTGGTGACAAATTCTGG - Intergenic
935867172 2:107402373-107402395 AACTAAGTGCTGAAAAAAATGGG + Intergenic
938544120 2:132312259-132312281 AACTAGGTATTAAAAAATAGTGG - Intergenic
939273397 2:139969254-139969276 ACCTAGGTGCAGAAAAACAGTGG - Intergenic
939705686 2:145449656-145449678 AAATAGGTACAGAAAAATAAAGG + Intergenic
940868315 2:158838516-158838538 CCCTAGGTGCTGAAAAATTTTGG - Intronic
943102766 2:183508162-183508184 GACAAGGTGGTTAAAAATACAGG + Intergenic
946721007 2:222607481-222607503 AACAAGGTGCAGAACAAGACAGG + Intronic
946892170 2:224288667-224288689 ATCTAGCAGCTGAAAACTACAGG - Intergenic
1170133220 20:13045167-13045189 AACTGGGTGCTGGAATATGCAGG - Intronic
1171755145 20:29100227-29100249 AACTATGTTCAGAAAAAGACAGG - Intergenic
1171872983 20:30544990-30545012 AACTAGGTATTAAAAAATAGTGG - Intergenic
1174176532 20:48648972-48648994 AACTATCTGCTGAAAGATTCTGG - Intronic
1176734140 21:10527425-10527447 ATCTAAGTGGTGAAAAATACTGG + Intronic
1176958652 21:15134859-15134881 AAATAACTTCTGAAAAATACAGG + Intergenic
1177286276 21:19055145-19055167 AGCTAGGTGATGAAAATAACTGG - Intergenic
1177481962 21:21701639-21701661 AATTAGGAGCTCACAAATACAGG + Intergenic
1178847565 21:36186542-36186564 AAAAAGGAGCTGAAACATACAGG - Intronic
1180561878 22:16622910-16622932 ATCTAAGTGGTGAAAAATACTGG + Intergenic
1183025531 22:35063351-35063373 AACAAGGTGCTGAAAACAACAGG - Intergenic
1183025649 22:35064223-35064245 AACAAGGTGCTGAAAACAACAGG + Intergenic
950915900 3:16644955-16644977 AACTACTTGCTGAAAACTTCAGG + Intronic
951341982 3:21499540-21499562 ACCTAGGTGATGAAATAAACTGG + Intronic
952883609 3:38000060-38000082 AACTAGGGCCTAAAAAATTCAGG - Intronic
955487644 3:59450694-59450716 AACTATTTGCTCAAAAATTCTGG - Intergenic
957231863 3:77529378-77529400 CAGTAGGTGTTAAAAAATACAGG + Intronic
958084072 3:88783210-88783232 AAATAGGTGAAGAAAAATAATGG - Intergenic
960324851 3:116283255-116283277 AACTAGGTACTTCAAAATTCTGG - Intronic
968868118 4:3226878-3226900 AACTATGTCTAGAAAAATACAGG - Intronic
970195394 4:13546639-13546661 TACTTGGTGCTGACAAATAATGG + Intergenic
970938887 4:21607818-21607840 GACTATGTTCTGAAAAATTCAGG - Intronic
971345889 4:25811182-25811204 ATCTAGTTGCTGAGATATACAGG - Intronic
972206275 4:36777074-36777096 AACTTTGTGCTGAGAAATAAAGG + Intergenic
972306153 4:37831979-37832001 AACTAGATATAGAAAAATACAGG - Intronic
975655907 4:76641055-76641077 AACTGTGGGCTGAAATATACTGG + Intronic
975891092 4:79028575-79028597 TACTAAGTTCTGAGAAATACAGG - Intergenic
978396955 4:108290898-108290920 AACAAGGTGCTGAACAACACGGG + Intergenic
978891003 4:113827436-113827458 TACTAGGAGCAGAAAAATTCAGG + Intergenic
979446650 4:120821475-120821497 ATCTGGGTGCTGAAAAAGGCAGG + Intronic
980437155 4:132791957-132791979 AAATAGGCGATAAAAAATACTGG - Intergenic
981077753 4:140607765-140607787 AAATAGATATTGAAAAATACAGG + Intergenic
982648046 4:158048677-158048699 AACTAAGTGGGGAAAAAAACTGG + Intergenic
984846574 4:184113262-184113284 AGCAAGTTGCTGAAGAATACAGG + Intronic
986105058 5:4651601-4651623 AAGTAGGTGCTCAAAAGGACTGG + Intergenic
988138787 5:27208974-27208996 AACTTAGTGCTAAAAAAGACTGG - Intergenic
989652968 5:43714061-43714083 AAATAGATTTTGAAAAATACTGG - Intergenic
993156128 5:84226431-84226453 AATTAAGTGTTGAAAAATTCAGG + Intronic
995021163 5:107368723-107368745 TAACAGGTGCTGGAAAATACTGG + Intergenic
995552275 5:113293493-113293515 AACTGGGTGCTGAAAAGAAGAGG - Intronic
997000029 5:129748361-129748383 ATCTAGGGGCACAAAAATACGGG + Intronic
998441693 5:142167976-142167998 AAACAGGTCCTGAAAGATACAGG - Intergenic
999352986 5:150894783-150894805 AACTTGGAGCTGAAAAACATTGG - Exonic
999976455 5:156916543-156916565 AACCAAGTTCTGAAAAATGCTGG - Intergenic
1002599314 5:180345334-180345356 TACTAGGTGCTGCAAGCTACTGG + Intronic
1003465741 6:6378219-6378241 ATCTAGCTGCTGAACAAAACAGG + Intergenic
1004812790 6:19277911-19277933 AACAAGGAGGTTAAAAATACAGG - Intergenic
1006783299 6:36647382-36647404 AACAAGGTATTGAAAAAGACTGG + Intergenic
1007672667 6:43568983-43569005 AACCATGTACTCAAAAATACTGG + Intronic
1013441438 6:110174354-110174376 AAGTAGGTGCTAAAAAGGACAGG - Intronic
1013570505 6:111419675-111419697 AACTAGATGTTGAAAAAAGCTGG - Intronic
1015531994 6:134230065-134230087 AATTAGATGCTGAGAAAGACTGG + Intronic
1015723599 6:136274122-136274144 AAATAGCTGTTGAAAGATACAGG - Intronic
1015834268 6:137403350-137403372 AACAAGTTCCTGAAAAATTCTGG + Intergenic
1024557511 7:50616001-50616023 AACTAGGTAATAAATAATACAGG - Intronic
1030213586 7:107020681-107020703 AACTAGGTGCTCAGAATTTCGGG - Intergenic
1030442378 7:109603232-109603254 AACTAGATACTTGAAAATACGGG - Intergenic
1032560637 7:132889213-132889235 AACCAGGTGCTGATACATTCAGG - Intronic
1033908171 7:146232342-146232364 AACTATGTCATGAAAAATATAGG - Intronic
1034008796 7:147505530-147505552 AACTAAGTGCTGATAATTGCTGG - Intronic
1035978556 8:4341243-4341265 AACTGCCTTCTGAAAAATACTGG - Intronic
1037006872 8:13792455-13792477 CAATAGATGCTCAAAAATACTGG + Intergenic
1037044770 8:14284681-14284703 AACAAGGTGCAGAAAATAACAGG - Intronic
1037354734 8:18005994-18006016 AAGAAAGTGCTGAAAAGTACTGG + Intronic
1038532419 8:28329121-28329143 AAGCAGGTGCTGGAACATACAGG - Exonic
1038804820 8:30780748-30780770 AAGTAATTGCTGATAAATACAGG + Intronic
1038995417 8:32917623-32917645 AACTAGTTTATGGAAAATACAGG - Intergenic
1039384947 8:37127298-37127320 AAGTAGATGCTCAAAAATGCTGG + Intergenic
1039406705 8:37319039-37319061 AAATAGGTGGTGAAAAGCACTGG - Intergenic
1044330062 8:90908536-90908558 AGATAGGGGCTGTAAAATACAGG - Intronic
1044786549 8:95800075-95800097 CATTAGGTCCTTAAAAATACTGG + Intergenic
1044819862 8:96148683-96148705 AACAAGGTGCTGCAAAGCACAGG + Intronic
1044940574 8:97338210-97338232 AACTAGATACAGCAAAATACAGG + Intergenic
1045153724 8:99441175-99441197 AATTCAGTGATGAAAAATACAGG - Intronic
1045941119 8:107739504-107739526 CACTAAGTCCTGAAAAAAACAGG + Intergenic
1046112690 8:109745247-109745269 AAATAGGATCTGAAAAATACAGG - Intergenic
1046213920 8:111117113-111117135 AACTATGTGATGATAAACACGGG + Intergenic
1051744566 9:20283192-20283214 AACTAGATGCTCAAAACCACTGG - Intergenic
1052290036 9:26829973-26829995 AACAAGGAGGTTAAAAATACAGG - Intergenic
1052319782 9:27155629-27155651 AAGTAGGTGCTCAAAAATTCTGG + Intronic
1053535710 9:38923571-38923593 AACTAGGTGCCCATAAATAGTGG + Intergenic
1188596284 X:31905019-31905041 AACGAGTTACTGAAAAATAGTGG + Intronic
1189577198 X:42366859-42366881 CACTAAGTTCTGAAAAATACTGG + Intergenic
1196137552 X:112226465-112226487 AGCTTGGTGCAGAAAAACACTGG + Intergenic
1196468725 X:116000241-116000263 AACTGAGTGCTGAACAATTCAGG + Intergenic
1196985231 X:121262296-121262318 AATTAATTACTGAAAAATACAGG - Intergenic
1198587934 X:138143464-138143486 AAGTAGATGATGGAAAATACAGG - Intergenic
1198628843 X:138612024-138612046 TTCTAGGAGCTGAAAAATACAGG + Intergenic
1198766044 X:140080207-140080229 AACAAGGAGCTTAAAGATACAGG - Intergenic
1199494498 X:148438143-148438165 AACTAGGAGCAGAAACATTCAGG - Intergenic
1200711640 Y:6490099-6490121 GACAAGGTGGTTAAAAATACAGG - Intergenic
1201022294 Y:9671881-9671903 GACAAGGTGGTTAAAAATACAGG + Intergenic
1202592162 Y:26496940-26496962 ATCTAAGTGGTAAAAAATACTGG + Intergenic