ID: 915128058

View in Genome Browser
Species Human (GRCh38)
Location 1:153679401-153679423
Sequence CTTGAGGTCCACCGCGGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915128058_915128064 5 Left 915128058 1:153679401-153679423 CCCTGGCCGCGGTGGACCTCAAG 0: 1
1: 0
2: 1
3: 2
4: 57
Right 915128064 1:153679429-153679451 GCACAACCCCGCTGTGTTCCTGG 0: 1
1: 0
2: 1
3: 6
4: 89
915128058_915128065 6 Left 915128058 1:153679401-153679423 CCCTGGCCGCGGTGGACCTCAAG 0: 1
1: 0
2: 1
3: 2
4: 57
Right 915128065 1:153679430-153679452 CACAACCCCGCTGTGTTCCTGGG 0: 1
1: 0
2: 2
3: 8
4: 124
915128058_915128068 12 Left 915128058 1:153679401-153679423 CCCTGGCCGCGGTGGACCTCAAG 0: 1
1: 0
2: 1
3: 2
4: 57
Right 915128068 1:153679436-153679458 CCCGCTGTGTTCCTGGGCCCCGG 0: 1
1: 0
2: 3
3: 33
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915128058 Original CRISPR CTTGAGGTCCACCGCGGCCA GGG (reversed) Exonic
900860129 1:5223004-5223026 CTCCAGCTCCACCGTGGCCAAGG - Intergenic
901238443 1:7679812-7679834 CCTGGGGTCCACCTCGGCCCAGG + Intronic
915128058 1:153679401-153679423 CTTGAGGTCCACCGCGGCCAGGG - Exonic
1063064573 10:2595134-2595156 CTTGAGGCCACCTGCGGCCAAGG + Intergenic
1075871233 10:125773847-125773869 CTTGATGTCGACCGCGGCCCCGG + Exonic
1078185696 11:9050516-9050538 CTGGAGGTCCATGGGGGCCAGGG - Intronic
1078326525 11:10386012-10386034 GTTGAGGTCCAGAGAGGCCAAGG + Intronic
1084857941 11:72000801-72000823 CTTGGGGTCCACTGCAACCAAGG - Intronic
1090793940 11:130117837-130117859 CTTGTGATCCACCCCGGCCTCGG - Intronic
1091097867 11:132840922-132840944 CTGGAGGTCCACCTGGGCCCTGG - Intronic
1114498430 14:23150491-23150513 CTTGAGGAACTCAGCGGCCATGG + Intronic
1116637649 14:47417793-47417815 CTTGAGCTCCAAGGAGGCCAAGG - Intronic
1121318312 14:92975182-92975204 CTTGAAGTCCTCCATGGCCAAGG + Intronic
1125497555 15:40211383-40211405 ATTGAGGTCCACAGCTGTCAAGG - Intronic
1128158287 15:65405983-65406005 CTTGAGATCCACCCAGGGCAAGG + Intronic
1132090989 15:98947899-98947921 CTTGAGGTCCAGTTGGGCCAAGG - Intronic
1132887802 16:2190083-2190105 CTTGATGTCCACAGCGGCCTGGG + Exonic
1136223355 16:28843119-28843141 CTTCAGGTCCTCCCCGGGCATGG + Exonic
1136656899 16:31714713-31714735 CCTGAGGTTCACAGCAGCCATGG + Intronic
1138278220 16:55751596-55751618 CTTGAGCTCCACCCCGTTCATGG - Intergenic
1141488625 16:84356907-84356929 CTTCAGGTTCACTGGGGCCAAGG + Intergenic
1147183852 17:38703401-38703423 TTTGGGGCCCACCGCTGCCAAGG - Intergenic
1148844882 17:50523800-50523822 CCTGATGTCCACAGGGGCCATGG - Intronic
1152987783 18:335214-335236 CTTTAGGTCCACCGGGCCCCAGG - Exonic
1161668348 19:5590369-5590391 CTGGGGGTCCTCCGTGGCCATGG + Exonic
1161972553 19:7590702-7590724 CTTGGGGTCCACGGAGGTCATGG + Intergenic
1167049944 19:47072096-47072118 CTGGGGGTCCACCGGGTCCAGGG + Exonic
1167668406 19:50836218-50836240 CTTCACCTCCACCGCGGCCTGGG + Intronic
1168685595 19:58347465-58347487 CTCGAGGTTCGCCGCGGCCCCGG + Exonic
925385519 2:3459341-3459363 GCTGAGGTCCACAGAGGCCAGGG - Intronic
925447890 2:3943211-3943233 CCTGAGGTCGGCCGGGGCCAGGG + Intergenic
932770786 2:74499699-74499721 CTCCAGATCCACCGCGGCCCGGG - Exonic
936671575 2:114662618-114662640 CTGGATGGCCACCGCGTCCACGG + Intronic
938067827 2:128291618-128291640 CTTGAGGTCCACCTTGCCCCAGG - Intronic
941225029 2:162838368-162838390 CTTGGCGTCCACCGCTTCCAAGG - Intronic
942706219 2:178775807-178775829 CTTGAGCTCCACAGCGGTAATGG + Exonic
942989757 2:182185962-182185984 CTTCAGGTCCACTGCTGCAAGGG + Exonic
946176235 2:217923257-217923279 CTTGAGGTCCACTGGGGGAAGGG - Intronic
948924348 2:241084532-241084554 CTTGATGTCAGCCGCTGCCATGG - Intronic
1169288055 20:4326010-4326032 CCTGAGGTCCAGCCTGGCCAAGG + Intergenic
1172628594 20:36363305-36363327 CTTGAGGTGCAGTGAGGCCATGG + Intronic
1172789697 20:37494398-37494420 CTTCCGGTCCCCCGGGGCCAGGG - Intronic
1179488420 21:41725744-41725766 CTTGAGGTCCCTCCCGGCAACGG + Intergenic
1179882681 21:44300104-44300126 CTCCAGGTCCACCGCGGCCATGG - Exonic
1179944771 21:44665815-44665837 CTTGAGATCCTCCGCGACCTGGG + Intronic
1181163842 22:20973295-20973317 CTTGAGCTCCACTGTGGGCAAGG - Exonic
952960139 3:38583879-38583901 CTTCATGTCCACAGCGGACACGG + Intronic
985653099 5:1116074-1116096 CTTTAGGGCCACCCTGGCCATGG - Intergenic
986747734 5:10759342-10759364 CTTGATTTCCACCCCGGGCAGGG - Intronic
991987806 5:72308126-72308148 ATTGGCGTCCACCGCGGCCCCGG + Intronic
1002019426 5:176353288-176353310 CTTGAGGACCACTGCTCCCAAGG + Intronic
1002157074 5:177291165-177291187 CTTCAGGTCCACCACTCCCAAGG - Intronic
1005534658 6:26743575-26743597 CCTGAGCTCCACCCCTGCCAAGG - Intergenic
1007236098 6:40392315-40392337 CTTGAGGTCCAGGGAGGCGAAGG + Exonic
1007782981 6:44264814-44264836 TTTGAGGTCCAGCTAGGCCATGG - Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1024674586 7:51626755-51626777 TTCCAGGTCCACCGTGGCCATGG + Intergenic
1061883009 9:133577368-133577390 CTTGAGGTCCCTCGCAGCCCCGG - Intergenic
1062669088 9:137695792-137695814 CTTCAGGTCCACCCAGGCAAAGG + Intronic
1200073321 X:153539440-153539462 CTTCTGTTCCACTGCGGCCAGGG + Intronic
1202115266 Y:21465670-21465692 CTTGAGGTCCCCCTGGGCCTCGG - Intergenic