ID: 915128077

View in Genome Browser
Species Human (GRCh38)
Location 1:153679470-153679492
Sequence GAAGCGCCCCACTGGGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915128077_915128084 -7 Left 915128077 1:153679470-153679492 CCGCCGCCCCAGTGGGGCGCTTC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 915128084 1:153679486-153679508 GCGCTTCACCGCGCACTGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 37
915128077_915128083 -8 Left 915128077 1:153679470-153679492 CCGCCGCCCCAGTGGGGCGCTTC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 915128083 1:153679485-153679507 GGCGCTTCACCGCGCACTGGCGG 0: 1
1: 0
2: 0
3: 2
4: 30
915128077_915128086 12 Left 915128077 1:153679470-153679492 CCGCCGCCCCAGTGGGGCGCTTC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 915128086 1:153679505-153679527 CGGGTCCCGCTGCTGACCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 100
915128077_915128091 27 Left 915128077 1:153679470-153679492 CCGCCGCCCCAGTGGGGCGCTTC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 915128091 1:153679520-153679542 ACCGCCGGCGCCCCGGCGCTGGG 0: 1
1: 0
2: 1
3: 5
4: 130
915128077_915128090 26 Left 915128077 1:153679470-153679492 CCGCCGCCCCAGTGGGGCGCTTC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 915128090 1:153679519-153679541 GACCGCCGGCGCCCCGGCGCTGG 0: 1
1: 0
2: 1
3: 21
4: 183
915128077_915128089 20 Left 915128077 1:153679470-153679492 CCGCCGCCCCAGTGGGGCGCTTC 0: 1
1: 0
2: 0
3: 10
4: 96
Right 915128089 1:153679513-153679535 GCTGCTGACCGCCGGCGCCCCGG 0: 1
1: 0
2: 1
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915128077 Original CRISPR GAAGCGCCCCACTGGGGCGG CGG (reversed) Exonic
909622381 1:77683069-77683091 GAAGCCCCCACGTGGGGCGGGGG - Intronic
912174643 1:107141113-107141135 GAGGCTCCCCCCGGGGGCGGAGG + Exonic
915128077 1:153679470-153679492 GAAGCGCCCCACTGGGGCGGCGG - Exonic
1064478821 10:15719775-15719797 GCAGCCACCCACCGGGGCGGAGG - Exonic
1068106253 10:52620525-52620547 GAAGCTGCCCACTGGGGTGCTGG + Intergenic
1076443418 10:130495800-130495822 GAAGCGCCCAACTAGGGTGTGGG - Intergenic
1076830661 10:132992683-132992705 GAAGCGCACCACGGCTGCGGAGG - Intergenic
1076908900 10:133377825-133377847 GGAGCGCCCCACTGAGCCAGCGG + Intergenic
1077499601 11:2903165-2903187 GGAGAGCTCCACTGGGGAGGGGG + Intronic
1083207526 11:61161500-61161522 CACGCGCGCCACTGGGGCGCCGG - Exonic
1083619699 11:64042697-64042719 GAAGCACCCCACTGTGACTGGGG - Intronic
1087842589 11:102935623-102935645 GAAGAGGCCCACTGAGGCGTTGG - Intergenic
1089273200 11:117315670-117315692 GGGGCGCCCCCCTGGGGCTGCGG - Exonic
1090193967 11:124799796-124799818 GAAGCGGGCCTCGGGGGCGGGGG - Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1103433062 12:120904234-120904256 GGAGCGCCGCGCTCGGGCGGCGG + Exonic
1104031314 12:125067146-125067168 GAAGCTCCCCACTGCTGTGGAGG - Intronic
1104915240 12:132260980-132261002 GAAGCCGACGACTGGGGCGGTGG + Intronic
1104980243 12:132570343-132570365 GCAGCGCCCCCCTGGGCCTGGGG + Exonic
1106810038 13:33350250-33350272 GCCGCGACCCACGGGGGCGGGGG - Intronic
1113613085 13:111661802-111661824 GAAGCACCCCGCGGGGGTGGGGG + Intronic
1114277401 14:21159148-21159170 GCAGCTCACCACTGGGGAGGAGG + Intergenic
1114277965 14:21165090-21165112 GCAGCTCACCACTGGGGAGGAGG - Intergenic
1115664566 14:35533829-35533851 GGAGCGTCCCACTGGGGAGCCGG - Intergenic
1121731041 14:96187341-96187363 GAAAGGCCCCACTGGGGCATGGG - Intergenic
1123183456 14:106491375-106491397 GACGAGCCCCACAGGGTCGGTGG + Intergenic
1123490508 15:20776070-20776092 GCAGCCCGACACTGGGGCGGCGG + Intergenic
1123547009 15:21345157-21345179 GCAGCCCGACACTGGGGCGGCGG + Intergenic
1131232805 15:90671860-90671882 GAAGTCCCACACTGGGGTGGAGG + Intergenic
1202955341 15_KI270727v1_random:72373-72395 GCAGCCCGACACTGGGGCGGCGG + Intergenic
1132839493 16:1972175-1972197 GAAGCGGCCCACTCCGGCCGCGG - Exonic
1137618104 16:49858550-49858572 GAGGCTCCCCAGAGGGGCGGAGG + Intergenic
1145816339 17:27797618-27797640 GAAAGGCTCCTCTGGGGCGGTGG + Intronic
1150283696 17:63943911-63943933 GAGGTGCCCCACTGAGGTGGGGG - Intronic
1151757695 17:76083949-76083971 GAAGAGGCCCACTGGGGCTGTGG + Intronic
1152354211 17:79798809-79798831 GAAGCGCCCCGCTTGCCCGGCGG - Intronic
1152736927 17:82001599-82001621 GATGCTCGCCACTGGGGCTGTGG + Intronic
1154448119 18:14450840-14450862 GCAGCCCGTCACTGGGGCGGCGG + Intergenic
1156508008 18:37610924-37610946 GTAGTTCCCCACTGGGGCGGTGG + Intergenic
1158674387 18:59505146-59505168 AAAGCTCCCCAGTGGGGTGGAGG + Intronic
1160500334 18:79398519-79398541 GAAGCCCAGCACTGGGGCGGGGG + Intronic
1163085881 19:14979592-14979614 GAAGCGCCCGGCCGGGGCCGCGG + Intronic
1164683147 19:30149420-30149442 GAAGCTCCCCACTGGGTGGAAGG + Intergenic
1165070053 19:33249685-33249707 GGAGCCCCCATCTGGGGCGGGGG - Intergenic
1165431385 19:35775484-35775506 CGCGCGCCCCACGGGGGCGGGGG - Intronic
927042746 2:19246115-19246137 GCAGAGCCCCTCTGGGGTGGAGG - Intergenic
927810102 2:26175803-26175825 GAAGGGCCCTACTGGGGCAGTGG - Intronic
929133587 2:38602475-38602497 GAAGCGACGCCCCGGGGCGGGGG - Exonic
929781903 2:44962488-44962510 GAAGAGCCCCACTGCGGCCGGGG - Intergenic
931728169 2:65130475-65130497 TCAGCGCCCCACGGGGGAGGGGG + Intergenic
935645443 2:105330019-105330041 GAAGCTCCCCGCAGCGGCGGGGG - Exonic
937482133 2:122272765-122272787 GAAGCCCCTCCCTGGGGAGGTGG - Intergenic
944831214 2:203535334-203535356 GCAGCGCCCCGCGGCGGCGGCGG + Exonic
946410622 2:219513542-219513564 GAAGAGCCCCAGTGGGGGCGTGG - Intergenic
946410987 2:219515038-219515060 GAAGCCCGCCACTGGGGCTGGGG - Exonic
947876970 2:233474078-233474100 GAGTCGCCCCTCTGGGGTGGGGG + Intergenic
1171877696 20:30593808-30593830 GCAGCGCCCTCCTGGGGCAGGGG - Intergenic
1172227963 20:33317724-33317746 GAAGCGCCTCTCTGAGGAGGAGG - Intergenic
1175328707 20:58148018-58148040 GAAGTGCCCCACGGGGGCTGGGG + Intergenic
1175999847 20:62826895-62826917 GAGGGGCCCCAGTGGGGCTGGGG - Intronic
1176546988 21:8206393-8206415 GAAGAGCCCCCCGGGAGCGGAGG - Intergenic
1176554893 21:8250602-8250624 GAAGAGCCCCCCGGGAGCGGAGG - Intergenic
1176565939 21:8389440-8389462 GAAGAGCCCCCCGGGAGCGGAGG - Intergenic
1176573814 21:8433627-8433649 GAAGAGCCCCCCGGGAGCGGAGG - Intergenic
1203251863 22_KI270733v1_random:122678-122700 GAAGAGCCCCCCGGGAGCGGAGG - Intergenic
1203259914 22_KI270733v1_random:167761-167783 GAAGAGCCCCCCGGGAGCGGAGG - Intergenic
961452554 3:127008959-127008981 GAAGCGCCCCACTGTGTCCCTGG - Intronic
962707736 3:138061693-138061715 GGAGCTCCCCACTGGGTCAGTGG + Intergenic
964851966 3:161104968-161104990 GAAGGGGCCCAGTGGGGCAGTGG - Intronic
968046418 3:195626140-195626162 GAAGCAGCCCACCGGGGCCGGGG + Intergenic
968308235 3:197663951-197663973 GAAGCAGCCCACCGGGGCCGGGG - Intergenic
968850454 4:3074474-3074496 GCAGCGCCCCACCCGGGCGAAGG - Intergenic
969284734 4:6196102-6196124 GCAGCTCCCCAGTGGGGCCGGGG - Intronic
977809848 4:101346555-101346577 GAAGGGCGCCGCGGGGGCGGGGG + Intronic
1006102261 6:31692987-31693009 GGAGAGGCCCACTGGGGTGGAGG - Intronic
1007336673 6:41159722-41159744 GCAGAGCCCCACGGGGGTGGGGG - Intronic
1012685436 6:102242417-102242439 AAAGCGTCCCACTGGGGTGCTGG + Intergenic
1016887054 6:148968456-148968478 GAAGCTCCCCAGTGTGGAGGTGG + Intronic
1017470666 6:154734123-154734145 GGAGGGCCGCCCTGGGGCGGAGG + Intronic
1019492495 7:1321865-1321887 GGAGCCTCCCACGGGGGCGGGGG + Intergenic
1027260688 7:76462271-76462293 GAAGGGACTCACTGGGCCGGGGG + Intronic
1027312067 7:76960384-76960406 GAAGGGACTCACTGGGCCGGGGG + Intergenic
1032238047 7:130141422-130141444 GGGGCGCCCTGCTGGGGCGGGGG - Intergenic
1033361338 7:140640721-140640743 GAAGCGCGCCGCTGGGGCCGGGG - Exonic
1040416705 8:47202229-47202251 GAAGCGTCACACTGGGGAGATGG + Intergenic
1042215966 8:66429814-66429836 AAAGCGCCCCACAGAGGCGGTGG - Exonic
1049432131 8:142570062-142570084 GCAGCCTCCCACTGGGGCTGTGG - Intergenic
1049436094 8:142586913-142586935 GAAGGACCCCACTGGGGCTCAGG + Intergenic
1049597283 8:143490478-143490500 CCAGGGCCCCACTGGGGAGGAGG - Intronic
1049718554 8:144105010-144105032 GCAGCGCCCCAGCGGGGCCGAGG + Intronic
1057547025 9:96026416-96026438 GGAGCGCCGCAGTGGGGCGGGGG + Intergenic
1059531792 9:115042247-115042269 GAAGCTCTCCACTTGGGCTGTGG + Exonic
1060978408 9:127778828-127778850 GAGGCGGCCCACAGGGGCTGGGG - Intergenic
1061238822 9:129357649-129357671 GAAGGGCCCCACAGGGGGTGGGG - Intergenic
1061570863 9:131476739-131476761 CAAGAGCACCACTGGGGTGGGGG - Intronic
1062287155 9:135778350-135778372 GTAGGGCCCCACTGGGCCTGAGG + Intronic
1062349297 9:136131319-136131341 GAAGCGCCACACTTGGGTGCGGG + Intergenic
1062653408 9:137590082-137590104 GATGGGCCCCAGCGGGGCGGGGG - Intronic
1203468265 Un_GL000220v1:105829-105851 GAAGAGCCCCCCGGGAGCGGAGG - Intergenic
1203476086 Un_GL000220v1:149801-149823 GAAGAGCCCCCCGGGAGCGGAGG - Intergenic
1188223232 X:27565777-27565799 GAAGCTCTCCACTGGGGAGAGGG + Intergenic
1189336257 X:40172481-40172503 GAAGCGCCCGAGCGGGGAGGAGG + Intronic
1192780830 X:74292616-74292638 GACGGGCTCCAGTGGGGCGGGGG - Intergenic
1192800338 X:74459485-74459507 GCAGAGCCCCAGTGGGGAGGGGG - Intronic
1194743728 X:97606138-97606160 GAACAGCCCCACTGGGGAGTGGG - Intergenic
1197513165 X:127396114-127396136 CCAAAGCCCCACTGGGGCGGGGG + Intergenic
1200062164 X:153488494-153488516 AAAGCGCCAGACTGTGGCGGGGG + Intronic