ID: 915128105

View in Genome Browser
Species Human (GRCh38)
Location 1:153679582-153679604
Sequence GGGGCCCAGCTACGCCAAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915128096_915128105 28 Left 915128096 1:153679531-153679553 CCCGGCGCTGGGCTTCGGTGTCA 0: 1
1: 0
2: 1
3: 7
4: 114
Right 915128105 1:153679582-153679604 GGGGCCCAGCTACGCCAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 95
915128097_915128105 27 Left 915128097 1:153679532-153679554 CCGGCGCTGGGCTTCGGTGTCAA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 915128105 1:153679582-153679604 GGGGCCCAGCTACGCCAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 95
915128095_915128105 29 Left 915128095 1:153679530-153679552 CCCCGGCGCTGGGCTTCGGTGTC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 915128105 1:153679582-153679604 GGGGCCCAGCTACGCCAAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915128105 Original CRISPR GGGGCCCAGCTACGCCAAGC TGG Exonic
905654938 1:39680501-39680523 AGGTCCCAGCTAAGCCAGGCTGG + Exonic
905922191 1:41727250-41727272 GGGGCCCAGAGAGGCTAAGCAGG + Intronic
905971302 1:42144521-42144543 GGGGCCCCGATTTGCCAAGCAGG - Intergenic
915128105 1:153679582-153679604 GGGGCCCAGCTACGCCAAGCTGG + Exonic
919771937 1:201167228-201167250 CGGGGCCAGCCACGCCACGCGGG + Intronic
922359637 1:224809731-224809753 GGGGCTCAGCCTGGCCAAGCTGG - Intergenic
924612878 1:245588482-245588504 GGGGCCCAGTGAAGCCCAGCTGG - Intronic
1068953726 10:62804175-62804197 TGGGCCCAGCTGGGCCCAGCTGG + Intergenic
1069619117 10:69825672-69825694 TGTGGCCAGCTAGGCCAAGCCGG + Intronic
1073431371 10:103489638-103489660 GGGGCGCCTCTAGGCCAAGCTGG - Intergenic
1076121373 10:127939685-127939707 GGGCCCCAGCTGAGCCCAGCAGG + Intronic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1076898794 10:133327010-133327032 GGGGCTCAGCCACGCCAGGCAGG + Intronic
1080639494 11:34150497-34150519 CAGGCCCAGCTAAGCTAAGCTGG - Intergenic
1081630170 11:44684067-44684089 CTGGCCCAGCTACCCCAGGCTGG + Intergenic
1085524124 11:77154589-77154611 GGGGAGCAGCCAGGCCAAGCAGG - Intronic
1090272381 11:125397214-125397236 GGTGCCCAGCTAAGTCATGCTGG + Intronic
1093562053 12:20552927-20552949 GGGCCGCAGCTATGCCATGCAGG + Intronic
1095719520 12:45385594-45385616 GGTGCCCAGCTGAGCCATGCTGG - Intronic
1096686864 12:53293787-53293809 GAGGCCCAGCCAGGCCCAGCAGG - Intergenic
1102149890 12:110681767-110681789 GGGGCCTAGCCAGGCCAAGCTGG - Intronic
1104070676 12:125342726-125342748 GAGCCCCAGCTTGGCCAAGCAGG + Intronic
1104847568 12:131854396-131854418 GGGGCACAGCTTCTCCAAGTTGG - Intergenic
1105439457 13:20403189-20403211 GGTGCCCAGCTTCGTCCAGCAGG - Intergenic
1113119966 13:106915728-106915750 GGGGCCAAGCTACACCCAGTAGG + Intergenic
1114536912 14:23428754-23428776 GGGGACCAGCCACGCCCTGCTGG - Intronic
1115217092 14:31025428-31025450 GGGGGCCAGATACGCCAAATCGG + Intronic
1122036187 14:98950790-98950812 TTGGCCAGGCTACGCCAAGCTGG + Intergenic
1127827967 15:62722453-62722475 GGTACGCAGCTCCGCCAAGCTGG - Exonic
1141445992 16:84058639-84058661 GGGGACCAGCCATGCCGAGCTGG + Intronic
1141734008 16:85840308-85840330 GGGGCCCAGCTCCTCCAGACTGG - Intergenic
1141903496 16:87007717-87007739 GGGGCCCAACTGGGCCTAGCTGG + Intergenic
1142291370 16:89195017-89195039 GGGGCCCCGCTTCGCCCGGCTGG + Exonic
1144548068 17:16215740-16215762 GGGGCCGAGCAGCGCCCAGCCGG + Intronic
1148209647 17:45800446-45800468 GGGGCCCAGAACAGCCAAGCTGG + Intronic
1151177997 17:72305070-72305092 GTGGCCCAGCCAGGCCAGGCAGG + Intergenic
1151700952 17:75742374-75742396 GGCGCCCCGCTCGGCCAAGCCGG + Exonic
1151759014 17:76090236-76090258 TGGGCCCAGCTGGGCCAGGCAGG + Intronic
1153838574 18:8986331-8986353 GGGACCCAGCTGAGCCATGCTGG - Intergenic
1154045331 18:10898863-10898885 GGGGCTCAGCAATGCCAAGATGG + Intronic
1161068761 19:2250377-2250399 GGGGGCCAGCTCCTCCAGGCGGG - Exonic
1161559053 19:4960719-4960741 GGGCCGCAGCTATGCCATGCAGG + Exonic
1162127272 19:8506314-8506336 GGGCCCCGGCTCCGCCCAGCAGG - Intergenic
1163312376 19:16522103-16522125 GGGGCCCAGGCAAGCCAGGCAGG - Intronic
1163430424 19:17264037-17264059 GGGGCCCAGCTGCTCCAGCCCGG + Exonic
1163433506 19:17282172-17282194 GGGGCCCTACTGCGCCAAGGCGG + Exonic
1165279334 19:34783228-34783250 GGGGCCATGCCACGCCATGCAGG + Intergenic
1166046926 19:40235319-40235341 GGGGCCCAGCGATGCCAAGGAGG - Exonic
1167648803 19:50719041-50719063 GGGGCCCAGGTACGCCAGGGAGG + Intronic
925056036 2:858048-858070 GGGGCCCAGCCACCTCGAGCTGG - Intergenic
925858218 2:8150832-8150854 GTGGCCGAGATACGCAAAGCAGG + Intergenic
926313889 2:11695622-11695644 GGGGCCCAGCTACCCTAAGCTGG - Intronic
928343081 2:30462410-30462432 GGGGCACAGCTTCACTAAGCAGG + Intronic
932218648 2:69983533-69983555 CGGGCCCAGCTAGGCTGAGCTGG + Intergenic
932405773 2:71511931-71511953 GGGGCCCAGCCAGGCCAACGTGG - Intronic
934751761 2:96798338-96798360 GGGGTCCAGCCACACCCAGCAGG - Intronic
937252531 2:120533768-120533790 GGGGCCTGGCCAGGCCAAGCAGG + Intergenic
945344192 2:208693552-208693574 GGGTCCCACCTACCCCCAGCTGG + Intronic
946541288 2:220687452-220687474 GGGGCCCAGCCCGCCCAAGCAGG + Intergenic
1175746429 20:61460375-61460397 GGGGCCCAGCTGAGAGAAGCTGG - Intronic
1175892944 20:62323333-62323355 GGGGCCCAGCCAGGACAAGTCGG - Intronic
1175962892 20:62646043-62646065 GTGGCCCAGCTGTGCCAGGCAGG + Intronic
1175965914 20:62660203-62660225 GGGGGACAGCTAAGCCAAGGTGG + Intronic
1181277578 22:21696280-21696302 GGGGCACAGAGACGCCAGGCAGG - Intronic
1181594404 22:23905010-23905032 GGGCCCCAGCTGAGCCATGCTGG + Intergenic
1182115075 22:27751787-27751809 GTGGCTCAGCTGTGCCAAGCTGG - Intronic
1185060345 22:48603281-48603303 TGGGCCCAGCAACGCCATGTGGG - Intronic
1185292931 22:50036153-50036175 GGGTCCCAGCTGAGCCCAGCAGG + Intronic
954004051 3:47578381-47578403 GGGTCCCGGCTACCCCAACCGGG + Intronic
959646726 3:108711919-108711941 GGGGCCCAGATCCAACAAGCTGG - Intergenic
960955451 3:123027683-123027705 AGAGCCCAGCTCCGCCGAGCCGG - Intronic
965103881 3:164335696-164335718 GGAGCCCACCTAAGCCAATCGGG - Intergenic
965584629 3:170306600-170306622 TAGTCCCAGCTACTCCAAGCTGG - Intergenic
968558733 4:1264975-1264997 GGGGCCCAGTCAACCCAAGCCGG + Intergenic
968878207 4:3285444-3285466 GAGGCCCAGCCACGCCACCCTGG - Intergenic
968967701 4:3777386-3777408 GGGGCCCAGTGAGACCAAGCAGG - Intergenic
971995221 4:33955789-33955811 GTGGCCCTGTTACTCCAAGCAGG + Intergenic
985541636 5:490161-490183 GGGGCCCAGCTGGTCAAAGCTGG - Intronic
988609622 5:32712307-32712329 GGCGCCCGCCTACGCCAAGATGG + Exonic
993743907 5:91572634-91572656 TGGGCCCAGCTGTGCCAAGCTGG - Intergenic
997736501 5:136216330-136216352 GGGGTCCTGCTACACCACGCAGG - Intronic
1002061932 5:176630334-176630356 GGGGCTCCGCTAGGCCAGGCCGG + Exonic
1002538401 5:179890937-179890959 GGAGCCGAGCCACGCCAAGGTGG + Intronic
1005670883 6:28105028-28105050 GGAGCCCAGCTCCCCCACGCGGG + Intergenic
1006956553 6:37878524-37878546 GGGGCAGGGCTATGCCAAGCGGG - Intronic
1009702283 6:67200617-67200639 GGCTCCCAGCAACCCCAAGCTGG - Intergenic
1013472316 6:110476489-110476511 GGGGCCCCGCGGCGCCACGCGGG - Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019747863 7:2710548-2710570 AGGGCCCAGCTAGGCCCTGCAGG - Intronic
1025855118 7:65269641-65269663 AGGGCCCAGCTGCGCCAACGGGG - Intergenic
1026949736 7:74339062-74339084 GGGGTCCAGCTTCGCCAAGTGGG - Intronic
1029386233 7:100245471-100245493 GGGGCCCATCTACCCCTTGCTGG + Intronic
1030858747 7:114596316-114596338 TGGGCACTGCTACTCCAAGCTGG - Intronic
1032076401 7:128838185-128838207 GGGGCACAGCCAGGCCAAGGAGG - Intronic
1032677210 7:134142028-134142050 GGGCCCCAACTACTCCAGGCTGG + Intronic
1034298297 7:149993330-149993352 GGTGCCCTGCGAGGCCAAGCAGG + Intergenic
1034807718 7:154103453-154103475 GGTGCCCTGCAAGGCCAAGCAGG - Intronic
1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG + Intergenic
1040936672 8:52788904-52788926 GGGGCCCAGCTAAGCCACCTAGG + Intergenic
1044604466 8:94036730-94036752 GGGCCCCAGCCACGCCAAACAGG + Intergenic
1055315901 9:75033881-75033903 GGGTCCCAGCTATTCCAACCTGG - Intergenic
1059436755 9:114281769-114281791 GGGTCCCAGCTGCGCCTTGCAGG - Intronic
1061002499 9:127910291-127910313 CGGGCCCAGCTACGCTTTGCAGG + Intronic
1062655555 9:137602944-137602966 GGGGCCCTGCCATGCCACGCAGG - Intergenic
1199593953 X:149492397-149492419 GGGGCTCAGATGCTCCAAGCAGG + Intronic