ID: 915135871

View in Genome Browser
Species Human (GRCh38)
Location 1:153731087-153731109
Sequence GGTCTGATAGGAAAACAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915135863_915135871 27 Left 915135863 1:153731037-153731059 CCCAGGAACACAGAGGTAGTTTC 0: 1
1: 0
2: 0
3: 20
4: 173
Right 915135871 1:153731087-153731109 GGTCTGATAGGAAAACAGGTTGG 0: 1
1: 0
2: 0
3: 9
4: 146
915135864_915135871 26 Left 915135864 1:153731038-153731060 CCAGGAACACAGAGGTAGTTTCC 0: 1
1: 0
2: 0
3: 11
4: 249
Right 915135871 1:153731087-153731109 GGTCTGATAGGAAAACAGGTTGG 0: 1
1: 0
2: 0
3: 9
4: 146
915135865_915135871 5 Left 915135865 1:153731059-153731081 CCTGACCATATATGCTTACTGTG 0: 1
1: 0
2: 0
3: 5
4: 109
Right 915135871 1:153731087-153731109 GGTCTGATAGGAAAACAGGTTGG 0: 1
1: 0
2: 0
3: 9
4: 146
915135866_915135871 0 Left 915135866 1:153731064-153731086 CCATATATGCTTACTGTGTGCTG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 915135871 1:153731087-153731109 GGTCTGATAGGAAAACAGGTTGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915135871 Original CRISPR GGTCTGATAGGAAAACAGGT TGG Intronic
900565144 1:3328483-3328505 GGGCTCTTAGGAAAGCAGGTGGG + Intronic
903825256 1:26140234-26140256 TGTGTGTTAGGAAAAAAGGTTGG + Intergenic
904122522 1:28209730-28209752 GGACTGGTAGGGAAAGAGGTAGG + Intronic
904855378 1:33493927-33493949 AGTTTGATGGGGAAACAGGTTGG + Intronic
906920518 1:50059583-50059605 GGACTGAAAGCAAAACAGGAGGG - Intronic
907819415 1:57952531-57952553 GGTCTGAGTGGAAAAAAGGGAGG + Intronic
907911953 1:58834766-58834788 GGACTGATAGGCAGACAGGTGGG - Intergenic
908035867 1:60052411-60052433 GGTCTCACAGGAAAAGAGCTTGG - Intronic
909136672 1:71809865-71809887 TGTCTGTTAGGATCACAGGTTGG - Intronic
912336219 1:108865651-108865673 GGTGTGGTAGGAAGACAGGTTGG - Intronic
915135871 1:153731087-153731109 GGTCTGATAGGAAAACAGGTTGG + Intronic
916570962 1:166027306-166027328 GGTCTGATCTGAAGACAGGCAGG + Intergenic
920822757 1:209396769-209396791 GGTCTGATAGAAGAGCATGTTGG + Intergenic
921701521 1:218273908-218273930 GGTCTATTAGGGACACAGGTTGG + Intergenic
922500663 1:226094822-226094844 GGGCTGGTGGGAAAACAGGATGG + Intergenic
924921182 1:248630950-248630972 GACGTGATATGAAAACAGGTCGG + Intergenic
1070966077 10:80531551-80531573 GTTCTGATACAAGAACAGGTAGG - Exonic
1071567737 10:86680416-86680438 GGGCTGATAGGAAGCCAGCTTGG + Intronic
1072294687 10:93997855-93997877 GAACTGGTAGGAAAAGAGGTGGG + Intronic
1072699146 10:97627486-97627508 GGTCTAATGTGAAAACAGCTAGG + Intronic
1072797276 10:98365703-98365725 GGACTCAGAGGAAAGCAGGTGGG + Intergenic
1079801135 11:24870400-24870422 ACTATGATTGGAAAACAGGTAGG - Intronic
1081549152 11:44096110-44096132 GGTTGGCTAGGAGAACAGGTGGG - Intronic
1082115482 11:48323806-48323828 GGTCGGTTAGGAAAACAGGGAGG + Intergenic
1083562261 11:63681975-63681997 GGGGTGTGAGGAAAACAGGTTGG + Intronic
1083736486 11:64684581-64684603 GGTGTGAAATGAGAACAGGTAGG + Intronic
1086241319 11:84695963-84695985 GGTCTTATTTGAAAACTGGTAGG - Intronic
1089498529 11:118919680-118919702 GGTCTGGGAGGAACACAGGCTGG - Intronic
1089679001 11:120109131-120109153 GGGCTGATAGGCAGGCAGGTTGG - Intergenic
1090092501 11:123710883-123710905 GGTGTAATAAGAAGACAGGTTGG + Intergenic
1091662789 12:2397029-2397051 CATCAGATATGAAAACAGGTTGG - Intronic
1091719673 12:2803585-2803607 GGTCTGATAAGAACCCAGGGTGG + Exonic
1093353615 12:18135080-18135102 GGTCTGAGGAGACAACAGGTTGG + Intronic
1100328975 12:93568443-93568465 GGTCAGAGAGGTAAACAGGCTGG + Intergenic
1100469233 12:94874719-94874741 GGACTGCTAGGAAAACCCGTGGG - Intergenic
1101203777 12:102464768-102464790 GCTGTGATAAGAAAACAGTTTGG + Intronic
1105507272 13:21021036-21021058 AGTCTGAGAGGAAGAGAGGTGGG + Intronic
1105543970 13:21338664-21338686 GGGCTGATGGGAAGACAGGAGGG - Intergenic
1106282901 13:28291872-28291894 TGTCTGATTGGAAAACAATTTGG + Intronic
1108269547 13:48746141-48746163 GGTGTGATAGGTGAACAGATTGG - Intergenic
1108745243 13:53386733-53386755 CGTCTGATAAGAAAAGTGGTTGG + Intergenic
1110396479 13:75035091-75035113 GGTCTGACATGTAAACAGTTTGG - Intergenic
1110937996 13:81317197-81317219 TGTCTGCTAGCAGAACAGGTTGG - Intergenic
1111236812 13:85419652-85419674 GGTCTCATGGGGAAACAGATTGG - Intergenic
1112235956 13:97637019-97637041 GATCTGATAGGAAACCAATTTGG + Intergenic
1114321769 14:21552551-21552573 GGTCTGAGAGGTAAACACTTGGG - Intergenic
1115367659 14:32576748-32576770 GGTCTGCTAGGAACACTCGTTGG - Intronic
1115694681 14:35883935-35883957 TGTCTTTTAGGAAAACAGTTTGG - Intronic
1116477672 14:45360476-45360498 GGACTGATGGAAAAACAGATGGG + Intergenic
1118117504 14:62797053-62797075 GGTGTGAAAGGAAAACATCTTGG - Intronic
1120484349 14:85092266-85092288 GGTCTGAATGGAAAAAAAGTTGG + Intergenic
1120618978 14:86739525-86739547 GGTATGAAAGGAAAACACCTTGG - Intergenic
1123961404 15:25405301-25405323 TATCTGATAGGAAAAAAAGTAGG + Intronic
1127641543 15:60920417-60920439 GATATGATAGGAAAAAATGTGGG - Intronic
1127996736 15:64157316-64157338 GTGCTCATAGGAAAACAGGCTGG - Exonic
1129673207 15:77618312-77618334 GGACTGGTGGGAAAAGAGGTGGG - Intronic
1129707068 15:77800316-77800338 TGTCTGATGGGAAACCAGCTGGG + Intronic
1130184010 15:81661650-81661672 GGCATCAAAGGAAAACAGGTTGG + Intergenic
1130188309 15:81707520-81707542 GGCATCAAAGGAAAACAGGTTGG + Intergenic
1130311650 15:82761236-82761258 GGTGTGATAGGAAAGCAGTGTGG + Intronic
1130840550 15:87696328-87696350 AGTCTGTTTGGAAAACAGTTTGG - Intergenic
1131830936 15:96354230-96354252 GGTCTGAAAGGAAAATCGTTTGG + Intergenic
1133572365 16:7054124-7054146 GGTGTGAAAGGAAAAGAGGGAGG - Intronic
1144503406 17:15808642-15808664 GTTCTGATAAGAAAACACATCGG - Intergenic
1146397128 17:32477320-32477342 GGTTTCAAAGGGAAACAGGTTGG + Intronic
1151188260 17:72379449-72379471 GAACTGATAGGAAACCAGGCCGG - Intergenic
1151406855 17:73893419-73893441 AGTCAGAGAGGAAAACAAGTAGG + Intergenic
1151846239 17:76657905-76657927 CGTCTCATAGAAAAAGAGGTGGG - Intergenic
1153727777 18:7975184-7975206 AGCCTGTTTGGAAAACAGGTGGG + Intronic
1154281537 18:13007532-13007554 GGACAGAAAGGAAAAGAGGTGGG - Intronic
1156746559 18:40398699-40398721 GGTCTGAAACCAAAATAGGTAGG - Intergenic
1159130963 18:64280008-64280030 GGTTTGGTAGGTAAACATGTAGG + Intergenic
1160306740 18:77747273-77747295 GGTCTGGTAGGTGCACAGGTGGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161522568 19:4733008-4733030 GGTGTGATCGGACACCAGGTAGG - Intergenic
1163632300 19:18423783-18423805 GGCCAGAAAGGAAAACAGGGAGG - Intronic
926040131 2:9666222-9666244 AGTCTGTTAGGAAAACAGAGGGG - Intergenic
927326293 2:21809626-21809648 GGTCTGAGAGGAAGGCAGTTTGG - Intergenic
931716254 2:65031338-65031360 GGACGGATAGGGAAACAGGTGGG + Intergenic
935933370 2:108154206-108154228 GGACTGAAAGGGAAACATGTGGG - Intergenic
937381038 2:121376535-121376557 GGTCGGGGAGGAAAACAGGCTGG + Intronic
938188023 2:129250725-129250747 AGTCTAATAGGATAAGAGGTAGG + Intergenic
940842225 2:158597438-158597460 AGTCTGCTAGTAGAACAGGTAGG + Intronic
941410456 2:165150049-165150071 GCTCTGATAGGAAAAAATTTGGG - Intronic
949024037 2:241756815-241756837 GAACTGACAGGAAAACAGCTGGG - Intronic
1169213963 20:3783274-3783296 GCTCTGAAAGGAAAAAGGGTAGG + Intergenic
1172079319 20:32326970-32326992 GGTTTGATAAGAACACAGTTTGG + Intronic
1173241493 20:41301485-41301507 GGACTGAAAGGAGACCAGGTTGG - Intronic
1173416168 20:42858113-42858135 GGTCTAATAGGTAGACAGGTAGG - Intronic
1173502944 20:43566750-43566772 GGTCTCACAGGCAACCAGGTTGG - Intronic
1175645124 20:60664401-60664423 GGGCTCAGAGGAAAACAGGCAGG + Intergenic
1175670347 20:60897206-60897228 GGTCTCATAGGATAAGAGCTCGG - Intergenic
1178188026 21:30246489-30246511 GTTCTGATAGGTTAACAGGATGG - Intergenic
1183883811 22:40859215-40859237 GAGCTGATAGGAAATCAAGTTGG + Intronic
950123389 3:10496557-10496579 GGGCTGAAAGGAAACAAGGTAGG - Intronic
952168574 3:30779050-30779072 TGTCTGATAGAAAAACAGACTGG - Intronic
956499081 3:69862275-69862297 CTTCTGATAGGAAGACAGGTTGG + Intronic
957727289 3:84084074-84084096 ATTCTGATAAGAAAACACGTGGG - Intergenic
959886476 3:111508141-111508163 GGTCTGATATGTAAAAAGTTTGG + Intronic
960528043 3:118732826-118732848 GGTCTGAGAGGAAAACAAAGAGG + Intergenic
963164794 3:142190319-142190341 CGTCTGATAGGTAAAGAGCTTGG + Intronic
963307524 3:143669701-143669723 GGTCTGATCAGAACACAGGTTGG - Intronic
967099388 3:186203713-186203735 GGTTTGATATGTAATCAGGTTGG + Intronic
967410351 3:189160725-189160747 GGTCTGGCAGGTAAACAGGGTGG - Intronic
968043200 3:195605478-195605500 TCTATGATAGGAAAAAAGGTAGG + Intergenic
976220190 4:82750732-82750754 GGTCTGCTAGGTGGACAGGTAGG + Intronic
979218341 4:118193052-118193074 GGTCTGATATGAACCCAGGGTGG - Intronic
981116265 4:140994356-140994378 GGTCAGATAGGCACACAGATGGG - Intronic
982140313 4:152311050-152311072 GAGGTGATGGGAAAACAGGTTGG + Intergenic
983269330 4:165543123-165543145 GGTCTTGTAGAAAAACAGATAGG + Intergenic
984255934 4:177390019-177390041 GGTCCAATAAGAAAACAGGAAGG - Intergenic
986684606 5:10265437-10265459 CCTCTGATAGGGAAACAAGTGGG - Exonic
986701655 5:10415874-10415896 GGTTTAAAAGAAAAACAGGTTGG + Intronic
989061300 5:37414490-37414512 GCAGTGATAGGAAAAGAGGTGGG - Intronic
990763991 5:59161996-59162018 GGTCTGATTTGAAAGCAGATTGG + Intronic
991344866 5:65653654-65653676 AGTCTGAAAGGAATGCAGGTTGG + Intronic
994929890 5:106168238-106168260 GGGCAGAGAGGAAATCAGGTAGG - Intergenic
995252303 5:110007317-110007339 GGCCTGATAGGACAATGGGTAGG + Intergenic
997020651 5:129997269-129997291 TGTCTGAGAGAAAAAGAGGTGGG - Intronic
1001817035 5:174678150-174678172 GTTAGGATAGAAAAACAGGTTGG - Intergenic
1003238624 6:4321791-4321813 GGTCTGCTGGGGAAACAGGTAGG - Intergenic
1009627776 6:66159477-66159499 GGTCTGATATGCAAAGAGTTTGG + Intergenic
1012015027 6:93839032-93839054 GGTCTTATAGGGATACAAGTCGG + Intergenic
1013661601 6:112303305-112303327 AGTCACTTAGGAAAACAGGTTGG - Intergenic
1016818250 6:148323643-148323665 GCTGTGATAGGAAAATAGCTGGG + Intronic
1017870320 6:158481272-158481294 GGACAGATAGCAAACCAGGTGGG + Exonic
1018138391 6:160801817-160801839 GGGCTCATAGAAAATCAGGTTGG + Intergenic
1018466640 6:164052473-164052495 GATCTGACATGGAAACAGGTTGG - Intergenic
1020594753 7:10191912-10191934 AGGATGATGGGAAAACAGGTTGG - Intergenic
1020970470 7:14931673-14931695 GGTCTGAGAGGAATCCATGTTGG - Intronic
1022418192 7:30196166-30196188 GGTCTGATAGGAGACCCTGTAGG + Intergenic
1025868290 7:65406346-65406368 TCTCTGTTAGGAAAAGAGGTGGG - Intergenic
1027564746 7:79777270-79777292 GGTATGATAGGAAAAGAAGGAGG + Intergenic
1028822106 7:95224239-95224261 TGACTGAAAGGAAAAGAGGTTGG - Intronic
1031955230 7:127936058-127936080 GGTCAGATGGGATAGCAGGTGGG + Intronic
1032834116 7:135657876-135657898 GGGCTGATAGGAGAGGAGGTAGG + Intergenic
1037526226 8:19727111-19727133 GGTGTGATTGAAAAGCAGGTCGG - Intronic
1037718687 8:21422274-21422296 TGTCTCATAGGGAAACAGGGAGG + Intergenic
1041660224 8:60394057-60394079 GGGCAGAAAGGAAAACAGATAGG - Intergenic
1048162917 8:132037551-132037573 GGTCTCAAAGGAAAACAGGCTGG + Intronic
1048361569 8:133701522-133701544 GGCCTGATGGAAACACAGGTAGG - Intergenic
1049382804 8:142325761-142325783 GGTCAGAGAGGAAAAGAGGCTGG + Intronic
1051494327 9:17702175-17702197 AGTCTGCTTGGAAAAAAGGTTGG + Intronic
1052180540 9:25521050-25521072 GGTCTAATAGGAAGAAAGATAGG - Intergenic
1055200126 9:73649057-73649079 TTTCTGAGAGGTAAACAGGTTGG - Intergenic
1055612668 9:78038941-78038963 GGTCTAATGGGACAGCAGGTGGG - Intergenic
1058828694 9:108796597-108796619 TCTCTGATAGGAAAGGAGGTGGG - Intergenic
1061999582 9:134209172-134209194 GGTGTGTTGGGAAGACAGGTTGG - Intergenic
1062129659 9:134885620-134885642 AGTCTGTGAGGAGAACAGGTGGG + Intronic
1186308848 X:8294963-8294985 GGTAAGACAGGAAAACAGTTGGG - Intergenic
1187266460 X:17738048-17738070 GGTCTGACAGGAAATCAACTCGG - Intronic
1188948212 X:36334796-36334818 TGTGAGATAGGAAAACAGCTAGG - Intronic
1189904755 X:45746511-45746533 GGTCGGATAGATAAACTGGTAGG + Intergenic
1190245371 X:48687270-48687292 GGGCTGTTAGGAGAGCAGGTGGG + Intronic
1196928807 X:120660784-120660806 GGTCTGAAATGCAAACAGGGCGG + Intergenic
1199880800 X:151973268-151973290 GGTCAGAGAGGAAAACAGCAGGG - Intronic