ID: 915138346

View in Genome Browser
Species Human (GRCh38)
Location 1:153749909-153749931
Sequence TAGAAAACAGGGCAGTTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915138346_915138351 3 Left 915138346 1:153749909-153749931 CCAGATAACTGCCCTGTTTTCTA 0: 1
1: 0
2: 1
3: 16
4: 169
Right 915138351 1:153749935-153749957 TCCAAAAAACTTACATCTTTTGG 0: 1
1: 0
2: 3
3: 15
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915138346 Original CRISPR TAGAAAACAGGGCAGTTATC TGG (reversed) Intronic
901866335 1:12109441-12109463 TGGAAAACACAGCAGTCATCTGG - Intronic
905837705 1:41142484-41142506 TAGAAAGCATGGCTGTTATAAGG - Intronic
906458448 1:46018773-46018795 TAGAAACCAGAGCAGTTCTCAGG + Intronic
907847328 1:58220919-58220941 TTGCAAACAGTGCAGTTATAAGG + Intronic
909326675 1:74360164-74360186 GACAAAAAAGGGCAGTTATGAGG - Intronic
909417903 1:75428228-75428250 CAGAAAGCATGGCAATTATCTGG + Intronic
910729656 1:90380733-90380755 TAAAAAACAGTGCAGTTATTGGG - Intergenic
911395524 1:97303024-97303046 TAGAAAACTGGGCACATTTCAGG - Intronic
912259452 1:108095790-108095812 TAGATAACTGGGGAGTTACCAGG - Intergenic
912281231 1:108316525-108316547 TAGTAAACAGTACATTTATCTGG - Intergenic
913249349 1:116899472-116899494 TAGAAAACAGGGAGGTGGTCAGG + Intergenic
914269283 1:146065298-146065320 TAGAAGACAGGTCAGCTGTCTGG - Exonic
914532116 1:148531985-148532007 TAGAAGACAGGTCAGCTGTCTGG - Exonic
915138346 1:153749909-153749931 TAGAAAACAGGGCAGTTATCTGG - Intronic
915266300 1:154720377-154720399 TAATCAATAGGGCAGTTATCAGG - Intronic
915729124 1:158040645-158040667 TATAACACAGAGCAGTTTTCAGG + Intronic
917274601 1:173318903-173318925 TACAAAACTGGGCAGTTGTTTGG + Intergenic
917455356 1:175181516-175181538 TAGAAAACTTGCCAGCTATCTGG + Intronic
917621497 1:176801284-176801306 TGGAAATCAGGGCAGTTAAAGGG - Intronic
918434373 1:184496104-184496126 TAGAAAAGGGGGCAGGTAACAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919312064 1:195923664-195923686 TAGAAAACACTGAAGTTTTCTGG + Intergenic
920135941 1:203769513-203769535 TAGAAACCAGGGCATTTAACAGG - Intronic
921774333 1:219079629-219079651 TAGAAAATGGGGCAGGGATCAGG - Intergenic
923099167 1:230798639-230798661 TACAAAACTGGCCAGTTACCGGG + Intronic
923690139 1:236184661-236184683 AAAAAAACAGGTCAGTCATCTGG - Intronic
1065039646 10:21679144-21679166 TATAAAACAGGCCATTTATCAGG - Intronic
1065508291 10:26451945-26451967 TTCAAAACAAGGCATTTATCTGG + Intronic
1066511355 10:36100572-36100594 TTCAGAACAGGGAAGTTATCAGG + Intergenic
1067215893 10:44302487-44302509 GAGAAAACAAGGCAGTTGTCAGG + Intergenic
1068570526 10:58623412-58623434 TAGAAAACTGGGTAGATCTCTGG - Intronic
1068657465 10:59590399-59590421 TGGAAAGCAGGGCTGTGATCAGG - Intergenic
1069307607 10:66990648-66990670 TAGAGAAAAGGACACTTATCTGG - Intronic
1074714200 10:116203053-116203075 TAGAAATGAAGGCAGGTATCAGG + Intronic
1079418626 11:20264555-20264577 TAGAAACCATGGCAGTTATGTGG - Intergenic
1080767578 11:35310761-35310783 TAGAAAACAGGGTAGTGAATGGG + Intronic
1082225982 11:49707364-49707386 TAGAAAACAAGGCTCTCATCTGG - Intergenic
1086175871 11:83890336-83890358 TGGAAAAAAGGGCAGAGATCTGG + Intronic
1086354421 11:85979711-85979733 CGGAAAACAGGGCAGTGCTCTGG + Intronic
1086358509 11:86032107-86032129 AAGATAACAGGGCAGAGATCTGG + Intronic
1086623112 11:88912376-88912398 TAGAAAACAAGGCTCTCATCTGG + Intronic
1092795030 12:12101885-12101907 TAGAACACAGCTCAGTTATTTGG - Intronic
1093971058 12:25376347-25376369 TAGAAAACAGGAAACTTATAAGG - Intergenic
1094403052 12:30083454-30083476 TAGAAAGCAGGTCAGTTTTGGGG + Intergenic
1095612482 12:44146309-44146331 TAGAAAAAAGTGAAGTTATCAGG - Intronic
1096350451 12:50894840-50894862 TAGAAAGCATGGTAGTTGTCAGG + Intergenic
1096369778 12:51059299-51059321 TATATAACAAGGCAGTTATAAGG + Intronic
1096937408 12:55297730-55297752 TGGAAAACAGTGCAGTCATGGGG - Intergenic
1101808490 12:108086917-108086939 CAGAGGACAGGGCATTTATCTGG - Intergenic
1104494223 12:129221561-129221583 CAGAAATCAGGGCAGTAACCAGG - Intronic
1105357666 13:19673809-19673831 TGGAAAACAAAGCAGTTCTCAGG + Intergenic
1105383961 13:19913112-19913134 TGGAAGACAGGGATGTTATCTGG + Intergenic
1106543083 13:30707321-30707343 TAGAAAATAGGGCAGGGATAGGG + Intergenic
1108301677 13:49083616-49083638 TAGAAAAGAGGGCAGTGACTTGG + Intronic
1108675519 13:52734468-52734490 TTGAAACCAGTGCAGTAATCAGG - Intronic
1109591852 13:64494694-64494716 AAGAAAACAGGTCACTGATCGGG + Intergenic
1110277208 13:73653496-73653518 TAGAAAATAGGGCATGTGTCTGG + Intergenic
1116529335 14:45948489-45948511 TAGAATACATAGCATTTATCAGG - Intergenic
1116918037 14:50544286-50544308 GAGAAAAGAGGGTAGTTATTGGG - Intronic
1118538683 14:66798415-66798437 TAGAAAGCAGGGAAGCCATCGGG + Intronic
1121005629 14:90489091-90489113 TGGAAAAAAGGGCAGACATCAGG + Intergenic
1124179896 15:27462933-27462955 TAAAACACATGGCAGGTATCAGG + Intronic
1127529512 15:59829787-59829809 TAAAAAACAGGGCAGGTAAAAGG + Intergenic
1132234096 15:100206203-100206225 TAGAAGACAGGGCTTTTCTCTGG - Intronic
1134762329 16:16725226-16725248 TAGAAGACAAGGCTGTCATCTGG - Intergenic
1134983730 16:18633944-18633966 TAGAAGACAAGGCTGTCATCTGG + Intergenic
1140869344 16:79092336-79092358 TTGAAAACAGGGCAGTAAAATGG + Intronic
1140974059 16:80042366-80042388 TAGAAAGCGGGGCCCTTATCAGG - Intergenic
1141110294 16:81266179-81266201 TGGAGAACAGGGCAGGGATCTGG - Intronic
1141216924 16:82033550-82033572 TGGACAACAAGGCAGTTATGAGG - Intergenic
1141473919 16:84259102-84259124 GAGAAAATATGGAAGTTATCTGG - Intergenic
1141879868 16:86850646-86850668 TAGAAGACTTGGCAGTTCTCTGG - Intergenic
1143794586 17:9326416-9326438 TAGAAAACAGGGAAGGAAGCTGG - Intronic
1144993077 17:19247423-19247445 TAGAAGTCAGGGAAGCTATCAGG + Intronic
1147653809 17:42077258-42077280 TCTAAAACAGGGCAATTAACAGG + Intergenic
1148937654 17:51176516-51176538 TAGAAAGCAGGGCAGAAATCAGG + Intergenic
1149995092 17:61402078-61402100 TAGACCACAGGGCAGTGACCCGG - Intronic
1153452871 18:5249065-5249087 TAGATGACAGGGCATTTATTAGG + Intergenic
1154522358 18:15243626-15243648 TAGAAACCAGCGCAGTGTTCTGG - Intergenic
1159039238 18:63307695-63307717 TGGAGAACAGGCCAATTATCTGG + Intronic
1159834198 18:73316871-73316893 TTGAAAACAGTGCACATATCAGG + Intergenic
1159836708 18:73345753-73345775 TAGAAAACAGGGGATTTATTTGG + Intergenic
1160001286 18:75026691-75026713 TAATAAACACGGCAGTTATTTGG - Intronic
925777827 2:7352161-7352183 AAGAAAACAGAATAGTTATCTGG - Intergenic
928440874 2:31290867-31290889 TAGAAAACAGAGCTGTTGGCTGG + Intergenic
934093109 2:88571832-88571854 TAGAACTCAGGGCAGAGATCTGG - Intronic
937499554 2:122463059-122463081 TAGACCACAGGGCAGTGATGAGG + Intergenic
937875115 2:126819304-126819326 GAGAAGACAGGGTAGTTATCAGG - Intergenic
938981317 2:136529943-136529965 GAGAAACAAGGGCAATTATCTGG - Intergenic
939488109 2:142842614-142842636 TAGAAAATAGGGCAGGTAGCAGG - Intergenic
941020149 2:160399072-160399094 TAGAAAACATGGGCTTTATCAGG - Intronic
941810255 2:169748508-169748530 AAGAAAACAGGGCAGAGACCAGG + Intronic
942074747 2:172346776-172346798 TTGCAAACAGGGCAATTTTCTGG + Intergenic
944547111 2:200810084-200810106 TAGATTACAGGGTAGTTTTCAGG + Intergenic
948857688 2:240737727-240737749 AAGAAACCAGAGCCGTTATCAGG + Intronic
1168992613 20:2107569-2107591 TAGAAAATAGTACAGTTGTCTGG + Intronic
1169288440 20:4328725-4328747 TAGCAAACAGGACAGAGATCAGG - Intergenic
1169320635 20:4630618-4630640 TGGAAAAGAGGGCAGTGATTAGG - Intergenic
1170199819 20:13730839-13730861 TAGATAACACGGCATATATCAGG + Intronic
1172927629 20:38553146-38553168 TGGAAAGCAGGGCACATATCAGG + Intronic
1173098658 20:40062593-40062615 TATAAAACATGACAATTATCAGG + Intergenic
1174560027 20:51424555-51424577 TACAAAAGAGGGCAGTGATGAGG + Intronic
1174891502 20:54399867-54399889 GTGAAAACAGGACTGTTATCAGG - Intergenic
1177228683 21:18290533-18290555 TTGAATACAGGTCAGTTATTAGG - Intronic
1179401272 21:41086287-41086309 AAGAAAACAGGGCTTGTATCTGG + Intergenic
1181107607 22:20584305-20584327 TGGAAGACATGGCAGTTCTCAGG - Intronic
1183046416 22:35224106-35224128 GTGAAAACAGGGCATTTATTAGG - Intergenic
949188257 3:1219630-1219652 TAGATCACAAGGCAGTTATGTGG - Intronic
949426900 3:3927559-3927581 TAGAAAACAGGGAAGTTTCAAGG + Intronic
950899658 3:16486218-16486240 TAGAAACCATTGCAGTCATCAGG - Intronic
951960055 3:28308074-28308096 TTGAAAATAGGGAGGTTATCTGG - Intronic
954109606 3:48426719-48426741 CAGAAAACAGGGCAGCTCTATGG + Intronic
957051166 3:75413459-75413481 TAGAGAACAGGTCAGTTGACCGG + Intergenic
958640303 3:96796825-96796847 TGGAAAACAAGGCAGTTACAAGG - Intergenic
962281130 3:134052676-134052698 TGGAAAACAGGGCAGACATTTGG - Intergenic
962799235 3:138875877-138875899 TGGGAGACAGGGCAGTTAGCAGG - Intergenic
963459217 3:145586651-145586673 TACAAAACAGGGCAGAATTCTGG + Intergenic
963664399 3:148164457-148164479 TAGGAAACAGGGCAGTTTTTTGG + Intergenic
964678709 3:159313811-159313833 TAGAAAACAAGGCAATAATGAGG - Intronic
965137496 3:164790539-164790561 TAAAAAACAGTGCAGCTAGCTGG - Intergenic
975343390 4:73266507-73266529 TAGAAAACTAGGGAGTGATCTGG + Intergenic
976758703 4:88525239-88525261 TAGAGAATAGGGCAGTTATCGGG + Intronic
977027470 4:91837385-91837407 TAGAAAAGTGGGCTGGTATCTGG + Intergenic
978139804 4:105305887-105305909 TAGAAAGCAAGGCAGATATGAGG + Intergenic
978281096 4:107015506-107015528 TAGAAAACAGGCCACTAATTGGG - Intronic
978465185 4:109001060-109001082 TAGAAAACAGGCCAGATAAGAGG + Intronic
979602626 4:122603293-122603315 TGGAACATAGGGCAGTTGTCAGG - Intergenic
979988716 4:127348194-127348216 TAAAAAACATGGCAGTTAGGTGG - Intergenic
983236146 4:165181448-165181470 TGGACAACAGGTCAGTTATCTGG + Intronic
983606797 4:169595981-169596003 TAGATAACAGGACAGTTTCCTGG - Intronic
983788665 4:171766168-171766190 TAGAAAAAATGGCAGATATTTGG + Intergenic
984000559 4:174236320-174236342 TAGAGAACAGTGTAGTTATATGG - Intergenic
988070520 5:26282800-26282822 TAGAAATCAGTTCATTTATCTGG - Intergenic
989168955 5:38456530-38456552 TAGAAAACAGTGGACTTTTCAGG + Intronic
990768385 5:59213882-59213904 TAGAAAACATGACAGATAACAGG - Intronic
992569082 5:78034707-78034729 TAGAAAACATGACATTTCTCAGG - Intronic
993427973 5:87794242-87794264 AAGCATACAGGGCAGTTACCTGG + Intergenic
993695104 5:91052261-91052283 AAGAAAACATGGAAGGTATCAGG - Intronic
996249082 5:121304639-121304661 TACAAAGCAGAGCAGTTATTTGG + Intergenic
997173852 5:131753558-131753580 TAGAAATCAAAGCAGTGATCAGG + Intronic
998838694 5:146230061-146230083 TAGAAAACAGGGCTCTATTCTGG + Intronic
999363604 5:151006751-151006773 AAGAAAACAGGGCAGTGGCCAGG - Intergenic
999712864 5:154333754-154333776 GAGAAAAGGGGGCAGTGATCAGG - Intronic
1001487131 5:172127756-172127778 TAGGAAACAGGGCAGCTGGCAGG - Intronic
1004158727 6:13194431-13194453 AAGAAAAGAGAGCAGTTCTCTGG + Intronic
1004681860 6:17903842-17903864 TAGAAAACAGTACAGTTGCCAGG + Intronic
1009310705 6:62149005-62149027 AAGGAAATAGGGCAGTTATTGGG - Intronic
1011010478 6:82697564-82697586 TAGAAAACAAGGCAGAAACCTGG - Intergenic
1014068568 6:117154853-117154875 TAGAAGACAGGGCAGTGAGATGG + Intergenic
1017022942 6:150155561-150155583 TAGAATACATGGAAGGTATCTGG - Intronic
1018256633 6:161926420-161926442 AAGAAAACAGGGAACTTATCTGG + Intronic
1020689643 7:11338668-11338690 GAGAGAACATGGCTGTTATCAGG + Intergenic
1022631638 7:32090997-32091019 TAGAAAACAAGGCATATATTTGG - Intronic
1023913025 7:44568797-44568819 CAGAGAACTGGGCAGTTTTCTGG - Intronic
1024613497 7:51087372-51087394 TAGAAAACAAATCAGTTATCAGG - Intronic
1024702014 7:51913855-51913877 GGGAAAACAGTGCAATTATCTGG + Intergenic
1024995444 7:55270508-55270530 TAGAAAACAGAGCTATAATCTGG + Intergenic
1025301898 7:57824801-57824823 TAGAGAAAAGGGCAGTGACCAGG - Intergenic
1026133813 7:67642039-67642061 GAGGACACAGGGCTGTTATCAGG - Intergenic
1026497486 7:70915866-70915888 TAGAAAACAGGGGATGTTTCTGG - Intergenic
1029644409 7:101844463-101844485 AAGAAAACAGGGGAATAATCTGG - Intronic
1030073247 7:105715411-105715433 TAGAAAACAGGGAAGCTCTGAGG - Intronic
1031117300 7:117682159-117682181 TAGAAAACACTGAAGCTATCTGG - Intronic
1031893065 7:127317533-127317555 TATAAAACAGGGCAGTGTTGTGG + Intergenic
1032937292 7:136747676-136747698 TAGAACACAGGACAGTTGTCAGG - Intergenic
1037860489 8:22401872-22401894 TAAAAAGCAGGGCAATTATGTGG - Intronic
1041968043 8:63703377-63703399 TAGCAATCAGGGCTGTTCTCAGG + Intergenic
1042874868 8:73432688-73432710 TAGAAAACAGGGCAGCAAGTGGG - Intronic
1046893955 8:119452637-119452659 GTGAAAACAGGGCTGTTATGAGG + Intergenic
1047363594 8:124192251-124192273 TAGAAAACAGAGCAGCCAGCAGG - Intergenic
1047868193 8:129052561-129052583 TGGAAAACAGAGCAGTTGTGTGG - Intergenic
1048216656 8:132501816-132501838 TAGAAAAGGGGGCAGGTCTCTGG - Intergenic
1048224958 8:132576181-132576203 TAGACAACAGGGCAGTAACAAGG - Intronic
1050075016 9:1854219-1854241 TAGAAAACAGGGCAGTATCTCGG - Intergenic
1054747508 9:68869517-68869539 TACAAAAACGGGCAGTTAGCGGG - Intronic
1061121234 9:128643807-128643829 GAGAACACAGGGCAGTTCTGTGG + Intronic
1187474987 X:19602627-19602649 TAAAAAATAGGGAAATTATCGGG + Intronic
1188031275 X:25267123-25267145 TAGAAAACTGTGCAGCCATCTGG - Intergenic
1188383007 X:29520649-29520671 TAGAAAACACGGAAGTAAACAGG - Intronic
1189710471 X:43806353-43806375 AAGAATACGGGTCAGTTATCTGG + Intronic
1191138875 X:57094694-57094716 TGCAAAACAGGGCAGCTATTGGG + Intergenic
1193573671 X:83174950-83174972 TAAAAAGGAGGTCAGTTATCTGG + Intergenic
1195381531 X:104275827-104275849 TATAAACCAGGTCATTTATCAGG - Intergenic
1197059357 X:122158874-122158896 TAGATAACATGGCAATTTTCTGG - Intergenic
1198127119 X:133656626-133656648 TCGAAAACAGGTCACCTATCTGG + Intronic
1199369505 X:147030608-147030630 TAGAAAACAGAGGAGAAATCTGG - Intergenic
1199810323 X:151342745-151342767 TAGAAAGCAGGGCAGACATAAGG - Intergenic