ID: 915141762

View in Genome Browser
Species Human (GRCh38)
Location 1:153772453-153772475
Sequence CCGTCTACACTGGACGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 28}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915141762_915141775 17 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141775 1:153772493-153772515 CTATGCCTGGAGCCAGGCTGGGG 0: 1
1: 1
2: 4
3: 31
4: 341
915141762_915141780 24 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141780 1:153772500-153772522 TGGAGCCAGGCTGGGGGCAGGGG 0: 1
1: 1
2: 35
3: 295
4: 2221
915141762_915141776 18 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141776 1:153772494-153772516 TATGCCTGGAGCCAGGCTGGGGG 0: 1
1: 0
2: 6
3: 38
4: 332
915141762_915141774 16 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141774 1:153772492-153772514 ACTATGCCTGGAGCCAGGCTGGG 0: 1
1: 0
2: 2
3: 12
4: 235
915141762_915141779 23 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141779 1:153772499-153772521 CTGGAGCCAGGCTGGGGGCAGGG 0: 1
1: 1
2: 9
3: 148
4: 1249
915141762_915141771 11 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141771 1:153772487-153772509 CCCAGACTATGCCTGGAGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 249
915141762_915141773 15 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141773 1:153772491-153772513 GACTATGCCTGGAGCCAGGCTGG 0: 1
1: 0
2: 1
3: 18
4: 247
915141762_915141767 4 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141767 1:153772480-153772502 GCCCTGGCCCAGACTATGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 184
915141762_915141781 28 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141781 1:153772504-153772526 GCCAGGCTGGGGGCAGGGGCAGG 0: 1
1: 2
2: 34
3: 328
4: 2275
915141762_915141778 22 Left 915141762 1:153772453-153772475 CCCTCGGCGTCCAGTGTAGACGG 0: 1
1: 0
2: 0
3: 3
4: 28
Right 915141778 1:153772498-153772520 CCTGGAGCCAGGCTGGGGGCAGG 0: 1
1: 0
2: 16
3: 155
4: 1289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915141762 Original CRISPR CCGTCTACACTGGACGCCGA GGG (reversed) Intronic
915141762 1:153772453-153772475 CCGTCTACACTGGACGCCGAGGG - Intronic
923324437 1:232868816-232868838 CTGTGTACACTGAAGGCCGAGGG + Intergenic
1068393877 10:56436088-56436110 CCAGCTACACTGGAGGCTGAGGG - Intergenic
1071767671 10:88686944-88686966 CCCTCTACACTGGAGGGAGACGG + Intergenic
1072884812 10:99263699-99263721 CCCTCTACACTCAACGCAGATGG + Intergenic
1077317620 11:1926361-1926383 CCGTCGCCACTCGAGGCCGAGGG - Intronic
1078033584 11:7780056-7780078 TCCTCTCCACTGGACGCCTAAGG + Intergenic
1079633091 11:22701712-22701734 CCAGCTACTCTGGACGCTGAGGG + Intronic
1085409544 11:76283056-76283078 CTGACTACCCTGGACGCAGAGGG + Intergenic
1110911676 13:80973533-80973555 CCATCTACTCTGGAGGCTGAGGG - Intergenic
1118220698 14:63852891-63852913 CGCTCTACACTGGCCGCCGAGGG + Intergenic
1132837070 16:1959523-1959545 CCCGCTACAGAGGACGCCGAGGG - Exonic
1152228560 17:79103657-79103679 CCCTCTACCCTGGGCTCCGAGGG - Intronic
1160966498 19:1749130-1749152 CCCTCCTCACTGGACGCCGTTGG - Intergenic
1167787370 19:51646963-51646985 CCACCCCCACTGGACGCCGATGG + Intergenic
946504403 2:220283250-220283272 CCGGCTACTCTGGAGGCTGAGGG + Intergenic
946508446 2:220326981-220327003 CCATGTACACTGGACTCAGATGG - Intergenic
1171125016 20:22594966-22594988 CCGTATACACTGGGAGCTGAGGG + Intergenic
1174219596 20:48943061-48943083 CTGTTTACAATGGACCCCGAGGG - Intronic
1175971135 20:62687335-62687357 GCGTCTACACTGAAGGCCAAGGG + Intergenic
1176413267 21:6460132-6460154 CCATCTACACTGGGCTCCGTGGG - Intergenic
1179688764 21:43068454-43068476 CCATCTACACTGGGCTCCGTGGG - Intronic
969536662 4:7760491-7760513 CCGTGGACTCTGGAAGCCGAGGG + Exonic
972523631 4:39885838-39885860 CCATCTACTCTGGAGGCTGAGGG + Intronic
974068460 4:57102260-57102282 CAGTCTACAGTGGACCCCGAGGG + Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571148 5:646020-646042 CTGTCCACACAGGCCGCCGATGG - Intronic
1003214455 6:4096672-4096694 CCGTCTACACTGGGAGGCTACGG - Intronic
1005611074 6:27525677-27525699 CCGGCTACTCTGGAGGCTGAGGG + Intergenic
1007445733 6:41904165-41904187 CCGGCTACTCGGGAGGCCGAGGG + Intergenic
1039552511 8:38453294-38453316 CCGTCTCCCCTGGAGGCCCAGGG + Intronic
1192431540 X:71115817-71115839 CCAGCTACTCTGGAGGCCGAGGG - Intergenic