ID: 915142274

View in Genome Browser
Species Human (GRCh38)
Location 1:153775162-153775184
Sequence TCGCGCCTTCCCTGAATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915142274_915142285 25 Left 915142274 1:153775162-153775184 CCTGGGATTCAGGGAAGGCGCGA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 915142285 1:153775210-153775232 CGAGCCGCGAGCAGTCCGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 46
915142274_915142277 -1 Left 915142274 1:153775162-153775184 CCTGGGATTCAGGGAAGGCGCGA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 915142277 1:153775184-153775206 AGCACCGCCCAGGACCTGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 166
915142274_915142278 0 Left 915142274 1:153775162-153775184 CCTGGGATTCAGGGAAGGCGCGA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 915142278 1:153775185-153775207 GCACCGCCCAGGACCTGGTAGGG 0: 1
1: 0
2: 1
3: 11
4: 111
915142274_915142284 22 Left 915142274 1:153775162-153775184 CCTGGGATTCAGGGAAGGCGCGA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 915142284 1:153775207-153775229 GTGCGAGCCGCGAGCAGTCCGGG 0: 1
1: 0
2: 0
3: 4
4: 44
915142274_915142286 26 Left 915142274 1:153775162-153775184 CCTGGGATTCAGGGAAGGCGCGA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 915142286 1:153775211-153775233 GAGCCGCGAGCAGTCCGGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 98
915142274_915142283 21 Left 915142274 1:153775162-153775184 CCTGGGATTCAGGGAAGGCGCGA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 915142283 1:153775206-153775228 GGTGCGAGCCGCGAGCAGTCCGG 0: 1
1: 0
2: 0
3: 6
4: 58
915142274_915142276 -5 Left 915142274 1:153775162-153775184 CCTGGGATTCAGGGAAGGCGCGA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 915142276 1:153775180-153775202 CGCGAGCACCGCCCAGGACCTGG 0: 1
1: 0
2: 0
3: 17
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915142274 Original CRISPR TCGCGCCTTCCCTGAATCCC AGG (reversed) Intronic
900881221 1:5382724-5382746 TCTCACTTTCCCAGAATCCCTGG + Intergenic
901051489 1:6427852-6427874 TCAGGCATTCCCTGAGTCCCTGG + Intronic
901672146 1:10862155-10862177 CCCCGACTCCCCTGAATCCCAGG - Intergenic
902089668 1:13893184-13893206 TCGCGCCCTGCCTGCCTCCCTGG + Intergenic
908360887 1:63367640-63367662 TCGCGCCTGCCGTGGGTCCCAGG - Exonic
909376486 1:74947948-74947970 TGGGGCCATCCCTGAGTCCCTGG - Intergenic
914359749 1:146923501-146923523 TAGCACTTTCCCTGAATCTCAGG + Intergenic
914494002 1:148176393-148176415 TAGCACTTTCCCTGAATCTCAGG - Intergenic
915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG + Intergenic
915142274 1:153775162-153775184 TCGCGCCTTCCCTGAATCCCAGG - Intronic
921866717 1:220094289-220094311 CCCCGCCTTCCCTGCAGCCCGGG + Exonic
923526087 1:234773767-234773789 TGGAGTCTTGCCTGAATCCCAGG - Intergenic
1067343080 10:45419747-45419769 TCGCTCCTTCCCTACACCCCTGG - Intronic
1067373581 10:45707037-45707059 TCATGCCTTCCCTCCATCCCAGG - Intergenic
1067380108 10:45765182-45765204 TCATGCCTTCCCTCCATCCCAGG + Intronic
1067881403 10:50048808-50048830 TCATGCCTTCCCTCCATCCCAGG - Intergenic
1067887807 10:50105837-50105859 TCATGCCTTCCCTCCATCCCAGG + Intronic
1071373661 10:84980013-84980035 TTAAGCCATCCCTGAATCCCTGG - Intergenic
1075112667 10:119599981-119600003 TCTCTCCTTCCCTGATGCCCAGG - Intergenic
1075429523 10:122368907-122368929 GCGTGCCTTCCCTGACCCCCTGG - Intergenic
1076569777 10:131425076-131425098 ACGCCCCTCCTCTGAATCCCTGG + Intergenic
1076697912 10:132255984-132256006 TGGCGGCTTCCCGGCATCCCTGG + Intronic
1078945561 11:16064687-16064709 TTGCGCCATCCTTGCATCCCAGG - Intronic
1080415000 11:32061317-32061339 TTGTGCCCTCCCTGAATCCTTGG - Intronic
1082025994 11:47572789-47572811 TCAGCCCTTCCCTGAATCCATGG - Exonic
1087970219 11:104471765-104471787 TCCCTCCTTCCCTCAAGCCCTGG - Intergenic
1089286268 11:117409873-117409895 GGGCCCCTGCCCTGAATCCCAGG - Exonic
1090718669 11:129452977-129452999 CCTCTCCTCCCCTGAATCCCCGG + Intergenic
1095983048 12:47983548-47983570 TCGAGCCTTCCCTGCACCCCTGG - Intronic
1097603733 12:61727047-61727069 TTAAGCCATCCCTGAATCCCTGG + Intronic
1099656010 12:85492581-85492603 TTGAGCCTTCCTTGGATCCCTGG + Intergenic
1104743124 12:131193398-131193420 TCCTTCCTTCCCTGAATCACTGG + Intergenic
1106172309 13:27298437-27298459 TCACGCCTTCCCTGACTTCTAGG - Intergenic
1107473245 13:40710969-40710991 TGGCGCGTTCCTTTAATCCCAGG + Intergenic
1110008007 13:70296653-70296675 CAGCAGCTTCCCTGAATCCCTGG + Intergenic
1115320662 14:32076835-32076857 TCGCGCCTTCCCAGGCTCCCGGG + Intronic
1115539671 14:34408600-34408622 TCGCTACTGCCTTGAATCCCTGG - Intronic
1117124386 14:52605862-52605884 TTGAGCCTTCCTTGCATCCCTGG + Intronic
1117776567 14:59189556-59189578 AAGCGCCTGCCCTGAAGCCCTGG + Intronic
1120822925 14:88929649-88929671 TCTCCCCTTCCCTAAGTCCCTGG + Intergenic
1121474069 14:94178107-94178129 TGTCCCCTCCCCTGAATCCCAGG - Intronic
1121682484 14:95805235-95805257 TTGAGTCTTCCTTGAATCCCTGG - Intergenic
1122053920 14:99079411-99079433 TCCTGCCTTCCCTGAACCCTGGG - Intergenic
1129367032 15:75062438-75062460 TCACGCCTTCCTGGAAGCCCAGG - Intronic
1129905162 15:79182198-79182220 TTGGGTCTTCCCTGACTCCCTGG + Intergenic
1130742852 15:86619781-86619803 TGAGGCCTTCCCTAAATCCCAGG - Intronic
1130931227 15:88429465-88429487 TGGCGCTTTTCCTGAATCCTAGG - Intergenic
1131150844 15:90046432-90046454 TGGCCCCTTCCCTGAGGCCCTGG - Intronic
1132853281 16:2034301-2034323 CCACGCCTTCCCTGCGTCCCAGG + Intronic
1132853462 16:2034812-2034834 CCACGCCTTCCCTGCGTCCCAGG + Intronic
1137028448 16:35500847-35500869 TCTCACCTGCCCTCAATCCCAGG - Intergenic
1138343704 16:56307244-56307266 TCCCTCCTTCCCAGAATCCCGGG + Intronic
1138505309 16:57475495-57475517 TCGCGCCTCACCTGAGTCGCAGG + Exonic
1144340058 17:14303083-14303105 TCGCGCCTTACCCGAAGCTCGGG - Intronic
1144483705 17:15647873-15647895 TCTCACCTTCTCTGAATCTCAGG - Intronic
1144914981 17:18717135-18717157 TCTCACCTTCTCTGAATCTCAGG + Intronic
1147290783 17:39441293-39441315 TCCCGCCTTCCCCCAGTCCCTGG - Intronic
1147951403 17:44109942-44109964 CCGCTCCTTCCCTCACTCCCAGG - Intronic
1148749076 17:49934507-49934529 AGGCGCCTTTCCTGAAGCCCTGG - Intergenic
1155778709 18:29802696-29802718 TCTCGCCTTGCCTCAATTCCTGG - Intergenic
1158644534 18:59232794-59232816 TCCTGCTTTCCCTGAGTCCCAGG - Intergenic
1158961291 18:62589740-62589762 TCCTCCCTCCCCTGAATCCCTGG + Intergenic
1160729338 19:633637-633659 TCGCGCCTCCGCTGCATCCTGGG - Intergenic
1160766660 19:811723-811745 CCGCCCCTTCCCTGAAGCTCAGG - Exonic
1160870764 19:1276788-1276810 CCGCGCCCTCCCTGCCTCCCGGG + Intronic
1162094538 19:8302714-8302736 ACCCACCTCCCCTGAATCCCCGG + Intronic
1163593042 19:18204908-18204930 TCGTGCCCTCCCTGTTTCCCGGG - Intergenic
1167088083 19:47324206-47324228 TTGCCCCTTCCCTGATTTCCTGG + Intergenic
1168526240 19:57090778-57090800 GCACTCATTCCCTGAATCCCGGG + Intergenic
926057184 2:9780933-9780955 TCGGGTCTTCCCTGGCTCCCAGG + Intergenic
933853154 2:86386999-86387021 TCCCTCCTTCCCTCAACCCCTGG + Intergenic
935973359 2:108553699-108553721 ACGAGCCTTCCCAGAATCTCTGG + Intronic
937754914 2:125525465-125525487 TTTCTCCTTCCCTCAATCCCTGG - Intergenic
940038065 2:149330588-149330610 TCGCTCCTTCCCTGAGCTCCCGG + Exonic
945373759 2:209054326-209054348 TTGAACCATCCCTGAATCCCTGG - Intergenic
945942292 2:215961757-215961779 TTGCCCTTTCACTGAATCCCAGG + Intronic
946303259 2:218839005-218839027 TCTCTCCTTCCCAGAGTCCCAGG + Intergenic
947983411 2:234428681-234428703 ACGGGCTTTCCCTGAATACCTGG - Intergenic
948704393 2:239779956-239779978 TCCCTCCCTCCCTGCATCCCAGG + Intronic
1168804712 20:665636-665658 TAGCACCTTCCCTGAGACCCTGG + Intronic
1175175040 20:57106402-57106424 TCGTGTCTTCCCTGAGCCCCCGG + Intergenic
1175503603 20:59467047-59467069 TGGAGCCTGCCCTGCATCCCTGG - Intergenic
1176547676 21:8208648-8208670 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1176555573 21:8252854-8252876 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1176574503 21:8435882-8435904 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1176611115 21:8987174-8987196 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1179625339 21:42646028-42646050 TCACATCTTCCTTGAATCCCTGG - Intergenic
1183258196 22:36776589-36776611 TCGCGGCTTCCCCGGTTCCCGGG + Intergenic
1203252550 22_KI270733v1_random:124933-124955 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1203260606 22_KI270733v1_random:170019-170041 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
954814992 3:53273395-53273417 TCTGGCCTTGCCTGAGTCCCAGG - Intergenic
956401410 3:68883856-68883878 TCGCTCCTGCCTTGAATTCCTGG - Intronic
956618496 3:71197340-71197362 TCCCGCCTTTCCTGATTCCTCGG - Intronic
959842581 3:110995460-110995482 TAGCTTCTTCCCTGAATTCCTGG - Intergenic
962240346 3:133746523-133746545 CCGCGCGTTCCCTGCAACCCGGG + Intronic
969509003 4:7606684-7606706 TCTAGCCTTCCCTGAAGCTCAGG - Intronic
970159613 4:13175708-13175730 TCACACCTTCCCTGACTCCCAGG + Intergenic
985476683 5:83444-83466 TCGAGCCTTCCCTGACCACCCGG - Intergenic
985476756 5:83684-83706 TCGAGCCTTCCCTGACCACCCGG - Intergenic
985476784 5:83774-83796 TCGAGCCTTCCCTGACCACCCGG - Intergenic
985476831 5:83924-83946 TCGAGCCTTCCCTGACCACCCGG - Intergenic
985477014 5:84494-84516 TCGAGCCTTCCCTGACCACCCGG - Intergenic
985477069 5:84674-84696 TCGAGCCTTCCCTGACCACCCGG - Intergenic
985477276 5:85334-85356 TCGAGCCTTCCCTGACCACCCGG - Intergenic
986581144 5:9267008-9267030 TCACGTCTTCACTGAATCTCAGG - Intronic
1000352536 5:160363198-160363220 CCACGCCCTCCCTGAATTCCAGG + Intronic
1001083960 5:168686968-168686990 TCCTGCCTTACCTGAAGCCCTGG + Exonic
1001596697 5:172903120-172903142 GCGTGCCTTCCCTGCATCCTGGG + Intronic
1003509846 6:6770638-6770660 TTGCCCCTTCCCTCAACCCCTGG - Intergenic
1005885169 6:30092067-30092089 TCCTGCCTGCCCTGAATCTCTGG + Intergenic
1014634360 6:123826518-123826540 TCTCCCCTTCCCTGAGTACCTGG + Intronic
1018267829 6:162044084-162044106 TTCTGCCTTCCTTGAATCCCTGG - Intronic
1022098181 7:27153776-27153798 GTGTGCCTTCCCTGAACCCCAGG + Exonic
1022477938 7:30723851-30723873 TAGCCCCTTCCCTGGTTCCCAGG - Intronic
1038772997 8:30501370-30501392 TGGTGCCTTCCCTGGCTCCCTGG + Intronic
1039715145 8:40100109-40100131 CCACGCCTTCCCTGAATTACTGG + Intergenic
1040461851 8:47656993-47657015 TCTCCCCTCCCCTGAGTCCCTGG - Intronic
1040532113 8:48274504-48274526 CCTCGCCCTCCCTGAAGCCCTGG + Intergenic
1049310998 8:141933799-141933821 TTGCTCCTTCCCTGACACCCTGG - Intergenic
1050310907 9:4352485-4352507 AAGGGCCTTCCCTGATTCCCAGG + Intergenic
1055869902 9:80863759-80863781 TCCCTCCCTCCTTGAATCCCTGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1058771076 9:108232339-108232361 TTAAACCTTCCCTGAATCCCTGG - Intergenic
1203468954 Un_GL000220v1:108084-108106 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1203476775 Un_GL000220v1:152056-152078 TCGCGCCTTCCCCGTCGCCCCGG + Intergenic
1186403625 X:9282461-9282483 TCTCTCCTTCCCTCAATCCCTGG - Intergenic
1194362363 X:92968725-92968747 TCTCCCCTTCCCTCAACCCCTGG + Intergenic
1195819925 X:108933519-108933541 TCGAACCATCCCTGTATCCCAGG + Intergenic
1195956630 X:110338050-110338072 TCTTGCCTTCCCTCAGTCCCTGG - Intronic
1196898640 X:120361974-120361996 TGGCTCCTTCCCTGAATCAAGGG - Intergenic
1196922566 X:120599553-120599575 TTGAGCCATCCTTGAATCCCAGG - Intronic
1197576031 X:128212368-128212390 TCCTGCCATCCCTGCATCCCTGG - Intergenic
1198307361 X:135396359-135396381 TCTCTCTTTCCCTGAGTCCCAGG - Intergenic
1200670610 Y:6084950-6084972 TCTCCCCTTCCCTCAACCCCTGG + Intergenic