ID: 915142497

View in Genome Browser
Species Human (GRCh38)
Location 1:153776136-153776158
Sequence CGGCGCGCGCGCGCTGGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 186}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915142483_915142497 24 Left 915142483 1:153776089-153776111 CCCACCGCCCTGCGCCGGGGCCC 0: 1
1: 0
2: 2
3: 22
4: 271
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186
915142490_915142497 3 Left 915142490 1:153776110-153776132 CCCCTGCTGCACTGCCTCCGCAG 0: 1
1: 0
2: 2
3: 23
4: 261
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186
915142491_915142497 2 Left 915142491 1:153776111-153776133 CCCTGCTGCACTGCCTCCGCAGC 0: 1
1: 0
2: 2
3: 30
4: 348
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186
915142485_915142497 20 Left 915142485 1:153776093-153776115 CCGCCCTGCGCCGGGGCCCCCTG 0: 1
1: 0
2: 1
3: 31
4: 437
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186
915142486_915142497 17 Left 915142486 1:153776096-153776118 CCCTGCGCCGGGGCCCCCTGCTG 0: 1
1: 0
2: 2
3: 27
4: 302
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186
915142492_915142497 1 Left 915142492 1:153776112-153776134 CCTGCTGCACTGCCTCCGCAGCT 0: 1
1: 0
2: 2
3: 28
4: 256
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186
915142484_915142497 23 Left 915142484 1:153776090-153776112 CCACCGCCCTGCGCCGGGGCCCC 0: 1
1: 0
2: 5
3: 74
4: 681
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186
915142487_915142497 16 Left 915142487 1:153776097-153776119 CCTGCGCCGGGGCCCCCTGCTGC 0: 1
1: 0
2: 1
3: 37
4: 385
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186
915142488_915142497 10 Left 915142488 1:153776103-153776125 CCGGGGCCCCCTGCTGCACTGCC 0: 1
1: 0
2: 8
3: 62
4: 602
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186
915142489_915142497 4 Left 915142489 1:153776109-153776131 CCCCCTGCTGCACTGCCTCCGCA 0: 1
1: 0
2: 0
3: 31
4: 311
Right 915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG 0: 1
1: 0
2: 0
3: 29
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915142497 Original CRISPR CGGCGCGCGCGCGCTGGTGC TGG Exonic
900088679 1:909987-910009 CGGCGCGGCCGGGCTGGTCCTGG + Intergenic
900349618 1:2228373-2228395 GGGGGCGCGCGGGCAGGTGCCGG - Intergenic
901506515 1:9689228-9689250 CGGCGCGCGCACGCTGGCTCTGG - Intronic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
905449116 1:38046035-38046057 CGCCGCCCGCGCCCGGGTGCAGG + Exonic
907278145 1:53328139-53328161 GGGAGCGCGCGCGCTGGCGGCGG - Intergenic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
910549754 1:88462789-88462811 AGGAGCGAGCGCGCTGCTGCGGG - Intergenic
913962991 1:143353793-143353815 GGGCGCGCGGGCGGAGGTGCGGG + Intergenic
914057346 1:144179378-144179400 GGGCGCGCGGGCGGAGGTGCGGG + Intergenic
914121800 1:144786988-144787010 GGGCGCGCGGGCGGAGGTGCGGG - Intergenic
915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG + Exonic
918480679 1:184974129-184974151 CGGAGCGCGCCGGCTGGGGCAGG + Intronic
919724564 1:200873406-200873428 CTGCGCGGGCGCGCTGCTGCTGG + Exonic
922958560 1:229625819-229625841 AGGCGCGCGCGCGCGCGGGCGGG - Intronic
923684137 1:236142389-236142411 CGGGGCGCGCGGGCCGGGGCGGG + Intergenic
924624587 1:245688205-245688227 CGGGCCGCGCGCTCTGGGGCTGG - Exonic
1064086241 10:12348830-12348852 CCGCGCGGGCGCCCTGGTGCTGG - Intergenic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1070954401 10:80454687-80454709 CGGCGAGTGCGCGCCCGTGCCGG + Intronic
1071573701 10:86711435-86711457 GGGCGGGCGCGCGCTGGAGTCGG + Intronic
1072891486 10:99329253-99329275 CTGCGCGCGTGGGCTGGTGGCGG - Exonic
1073287951 10:102399653-102399675 GGACGCGCGCGCGCTGCTGGCGG + Exonic
1075664193 10:124219241-124219263 CGGCGTGCTGGGGCTGGTGCGGG - Intergenic
1075801848 10:125159410-125159432 CGGCGGGCGCGGGCGGGGGCCGG - Intronic
1077100327 11:819634-819656 CGCCGCTCGCTCGCTGGAGCCGG - Exonic
1077124339 11:925819-925841 GTGCGCGTGCGTGCTGGTGCGGG + Intronic
1077495804 11:2886015-2886037 CGGGGCGAGCGCGCTGTAGCAGG + Intergenic
1081870720 11:46381539-46381561 CGGGGGGCGCGGGCTGGAGCGGG + Intronic
1083436443 11:62646633-62646655 CTGAGCGCGCGCGATGGGGCGGG - Intronic
1083747636 11:64744645-64744667 CGGCGCGGGCGGGCTGGGGGCGG - Intronic
1084010940 11:66347859-66347881 CGGCGCGCGCACCCTGGACCGGG + Intergenic
1085423035 11:76380530-76380552 CGGAGCACGTGCGCTGGTGGGGG - Intronic
1096099029 12:48957603-48957625 CGGCGGCCGGGCGCTGGAGCTGG + Intergenic
1096741253 12:53695655-53695677 AGGCGAGGGCGCGCTGGGGCGGG + Intergenic
1096856810 12:54489108-54489130 CGGCGCGCGCCCGCAATTGCAGG + Intergenic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098425846 12:70365766-70365788 GGGCTGGCGCGCGGTGGTGCCGG - Intergenic
1100565323 12:95789845-95789867 GGGCGCGCGTGGGCTGGGGCCGG - Intronic
1102084397 12:110124285-110124307 CCGCGCGCGCGCGCACGAGCTGG - Intergenic
1105026734 12:132853882-132853904 CGGGGCGTGCGCGCACGTGCTGG - Intronic
1106087783 13:26558252-26558274 CTGCGCGCCCTCGCTGGTTCTGG + Intronic
1106264712 13:28100126-28100148 CGGCCCGCGCGCTCGGGTGCTGG - Intronic
1112290828 13:98143130-98143152 CGGCGCGGGCGCAGCGGTGCGGG + Intronic
1113513721 13:110874798-110874820 CGGGGCGCCGGCGCGGGTGCAGG - Intergenic
1113806131 13:113110721-113110743 TGGCGCGCCGGCGCCGGTGCAGG - Exonic
1117647337 14:57865876-57865898 CGGGGCCCGGGAGCTGGTGCAGG + Intronic
1117876034 14:60250061-60250083 CGGCGCGCCCGAGCGGGTGGGGG - Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1123037942 14:105478905-105478927 GGGCACGCGCGGGCTGGGGCTGG + Intronic
1126786308 15:52180048-52180070 CAGAGCGCGCGCCCAGGTGCGGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1130076713 15:80695693-80695715 CGGCGCGCTCGCTGAGGTGCAGG - Exonic
1131290156 15:91100208-91100230 CGGCGTGGGCGCGGTGATGCAGG + Intronic
1131827070 15:96330567-96330589 CGGCGCGCGCGCGCCTGGCCAGG + Intronic
1132809738 16:1791814-1791836 CAGCCTGCGCGAGCTGGTGCTGG - Exonic
1132893109 16:2214267-2214289 CGACGTGCGCGCGGTGGTGGTGG - Exonic
1133188483 16:4116472-4116494 CCGCGCGTGCGCGCTGCGGCTGG - Intergenic
1135691211 16:24539515-24539537 CGGCGCGCGCGAGGCGGGGCTGG - Intronic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1136408915 16:30065364-30065386 CGGGCCGCGCGCGCTGGGCCTGG + Intronic
1136478533 16:30527259-30527281 GAGCGGGCGCGCGCAGGTGCCGG - Intronic
1136518747 16:30783304-30783326 CTGTGTGCGTGCGCTGGTGCTGG + Exonic
1136625231 16:31458313-31458335 CGGTGTGAGCGCGCTGGTGCTGG + Intronic
1136630893 16:31488743-31488765 CGGCGACCGCGAGCTGCTGCTGG + Exonic
1138651467 16:58463720-58463742 CGACGCGCGGGTGCAGGTGCGGG - Intronic
1141608726 16:85169740-85169762 CGGCGCGCGCGAGCTGTCCCCGG + Intergenic
1142271833 16:89093914-89093936 CGCCGCGCGCGCGCCGGGGTCGG - Exonic
1142429746 16:90019569-90019591 GGGCGCGCGCGGGCCGGGGCGGG - Intronic
1142676524 17:1516849-1516871 CGGCGGGCGCGGGCTGGGCCGGG - Exonic
1143656279 17:8295551-8295573 CGGCGGCCGAGCGCTGGTGGCGG - Intergenic
1146053309 17:29568665-29568687 CGGCGCGGGGGCGCTGGGGCTGG + Exonic
1146339666 17:32007851-32007873 CCGGGCCCGTGCGCTGGTGCCGG - Intronic
1147588395 17:41666092-41666114 CGGCGCGCGTGCGCAGGAGGAGG - Intergenic
1147636353 17:41966830-41966852 CGGCCCCGGAGCGCTGGTGCCGG + Exonic
1148945655 17:51260061-51260083 CGGCGCAGGCGCGCTGGGGAGGG - Exonic
1150653537 17:67025006-67025028 CCGCCCGCCCGGGCTGGTGCTGG + Intronic
1152468337 17:80477644-80477666 AGGCGCGAGTGCGCGGGTGCCGG - Intronic
1152865310 17:82719007-82719029 CGGCGGGAGCGTGCTGGTGATGG + Exonic
1155007326 18:21740992-21741014 CGGAGCGCGGCGGCTGGTGCGGG + Intronic
1157753104 18:50195271-50195293 CGCCGCGCGCGCGCAGGCACAGG + Intergenic
1160499785 18:79395987-79396009 CGGTGCCCGCGCCCTGCTGCTGG - Intronic
1160631262 18:80247578-80247600 CGGGGCGCGGGCGCGGGCGCCGG - Intergenic
1160653411 19:246523-246545 CGGCGCGCCGGCGCCGGCGCAGG + Intergenic
1160739639 19:680008-680030 CGGTGCGCGCGGGCCGGGGCGGG - Intronic
1160967547 19:1753307-1753329 CCGCCCGCGCCCGCTGGGGCAGG - Exonic
1160983376 19:1826852-1826874 AGGCGCGCGGGTGCTGGGGCTGG - Intronic
1161108728 19:2456726-2456748 CCGCGTCCGCGCGCTGGAGCTGG - Exonic
1161956901 19:7501164-7501186 CGGCGTGCGCGTCCTCGTGCAGG - Exonic
1162741346 19:12775509-12775531 CTGCGGGCGCTCGCTGGTGGCGG - Exonic
1162914335 19:13865926-13865948 CGGCGCGCGCGCGTTCGTGAAGG + Intronic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1165428339 19:35757595-35757617 CGGGGGCCGCGCGCTGGGGCTGG + Intronic
1167001201 19:46746511-46746533 GGGCGCGCGCGCGGTGGTTGCGG - Exonic
1167072771 19:47230534-47230556 GGGCGCGCGCCCGCTGGGGGCGG - Intronic
1167074291 19:47239625-47239647 CGGGGGCCGCGCGCTGTTGCTGG + Intergenic
1167495813 19:49818249-49818271 CGCCGCGCGCGCGCTCGCGTCGG - Intergenic
1168336571 19:55600503-55600525 CGGGGCGCGAGCGCGGGAGCAGG - Intronic
1168474122 19:56663875-56663897 CCGTGTGCGTGCGCTGGTGCAGG + Exonic
1168474270 19:56664715-56664737 CCGTGTGCGTGCGCTGGTGCAGG + Exonic
925034844 2:677146-677168 CGGAGCGCGCGCGCTGGGCAGGG - Intronic
927561572 2:24077191-24077213 CGGGGCGCGCGGGCAGGTGCCGG + Intronic
929313284 2:40450370-40450392 GCACGCGCGCGCGCTGGTGGGGG + Intronic
929448034 2:42015472-42015494 CGGCGCGCGCCCGCAATTGCAGG + Intergenic
929452519 2:42047333-42047355 CCACGCGCGCTCGCAGGTGCTGG + Intergenic
929468619 2:42169313-42169335 CTGCGCGCGGGCGCGGGGGCGGG + Intergenic
929776644 2:44934626-44934648 AGGCGCGCGCGCGCGCTTGCGGG - Intergenic
929778471 2:44942872-44942894 CGGCGCGGTCGCGCTGCCGCCGG - Exonic
930711910 2:54557940-54557962 AGTCGCGCGCGCCCAGGTGCGGG + Intronic
930730632 2:54724776-54724798 TGAGGCGCGCGCGCCGGTGCCGG + Exonic
934277986 2:91589065-91589087 GGGCGCGCGGGCGGAGGTGCGGG + Intergenic
934978347 2:98821932-98821954 CGGGGGGCGCGGGCTGGTGCGGG + Exonic
938338917 2:130522796-130522818 CCGCGCGGCCGCGCTGCTGCAGG + Exonic
938350921 2:130597954-130597976 CCGCGCGGCCGCGCTGCTGCAGG - Exonic
940453806 2:153872148-153872170 CGGCGCTCGCGGGCCGGCGCGGG + Exonic
948115825 2:235493985-235494007 CGGGGCGCGGGCGCGGGCGCGGG + Intergenic
948858404 2:240741252-240741274 CGGCGAGTGAGTGCTGGTGCTGG - Exonic
1169113221 20:3046303-3046325 CCGCCCGCGCGCGCTGGTGACGG + Intronic
1169262570 20:4149121-4149143 CGGCGCTCGGGCGCTCGGGCGGG + Intronic
1169345154 20:4823327-4823349 CGGCGCGGGCGCGATGCAGCTGG - Intronic
1172155363 20:32820182-32820204 CGGCGCGCGCGGGCTGGGCCTGG + Intronic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176207094 20:63895102-63895124 GGGAGCGCGCGCGCCGGTGCGGG + Intergenic
1176549957 21:8216880-8216902 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1176566682 21:8391881-8391903 CGGCGCGCGCGTGCCCGAGCCGG + Intergenic
1176568883 21:8399914-8399936 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176576797 21:8444149-8444171 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1178535105 21:33404018-33404040 CGGCGCGGGCGCGCGGGTGGGGG - Intronic
1179563934 21:42234800-42234822 CCCCTCGCGCGCGCAGGTGCGGG + Intronic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1184337513 22:43862442-43862464 CGGGGCGCGGGCGCGGGCGCGGG - Exonic
1203254847 22_KI270733v1_random:133206-133228 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1203262903 22_KI270733v1_random:178285-178307 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
949501585 3:4685158-4685180 GGGCGCGCACGCCGTGGTGCTGG + Exonic
950438520 3:12994257-12994279 CGGCGCACGGGCGGTGGGGCGGG - Intronic
952889253 3:38029808-38029830 CGGGGCGCGCCCGCTGGCCCGGG - Intergenic
954437490 3:50503733-50503755 CGGCGGGGGCGCGCGGGGGCGGG - Intronic
954879482 3:53823798-53823820 CGCCGAGCGCGTGCTGCTGCTGG - Exonic
954886796 3:53881993-53882015 CATCGTGCCCGCGCTGGTGCCGG - Exonic
962106605 3:132396454-132396476 AGGCGCTCGCGGACTGGTGCAGG + Intergenic
968636486 4:1683777-1683799 CGGTGCCCGCCCGCTGCTGCCGG - Intronic
969032751 4:4227271-4227293 GGGCGCGCGGGCGGAGGTGCGGG - Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
985537513 5:473412-473434 CGGAGCCCGGGCGCTGGGGCGGG + Intronic
985995781 5:3596168-3596190 CGGCGAGCGCCCGGGGGTGCTGG + Exonic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
997869963 5:137498474-137498496 CGGCGAGCGCGTCCAGGTGCCGG + Exonic
998083356 5:139294468-139294490 CCGCGCGCGCGCGCGCGTGTGGG - Intronic
1002291592 5:178204386-178204408 CGGCGCGCGCGCTCTAGACCTGG - Intergenic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1003661194 6:8064145-8064167 TGGCGCGCGTGCGTTTGTGCGGG - Intronic
1004069728 6:12287754-12287776 AGGCGCGCGCGCGCGCGCGCAGG + Intergenic
1004262067 6:14117537-14117559 CGGCCCGGGCGCGCGGGGGCGGG + Intronic
1005964878 6:30720285-30720307 GGGCGCGCGTGCGCCGGGGCTGG - Exonic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1010001703 6:70955895-70955917 CGGGCTGCGCGCGCTGGTGCTGG + Exonic
1011640469 6:89412323-89412345 GAGCGCGCGCGCGCCCGTGCGGG - Intergenic
1012245763 6:96924430-96924452 CAGCGCGCGCCCGCCGGTCCCGG - Intergenic
1012872901 6:104693059-104693081 ACGCGCGCGCGCGCTGGGGTGGG + Intergenic
1019588516 7:1817306-1817328 CTGCGCGCCCGGGCGGGTGCTGG - Intronic
1022018442 7:26376209-26376231 CGGCGGGAGCGCGCGTGTGCGGG - Intergenic
1023181782 7:37492142-37492164 CGGCGCTCGCCTGCTGGCGCGGG + Intergenic
1023881860 7:44325324-44325346 CGGCGCGCGCGGGCTGGGCCGGG - Intronic
1024262411 7:47582196-47582218 CGGGGCGCGGGCGCGGGGGCCGG - Intronic
1026850323 7:73719573-73719595 GGGCGGCCGCGCGCTGGGGCCGG + Intronic
1029390726 7:100272175-100272197 CGGCGCGCGGGTGCCGGCGCGGG + Exonic
1029487535 7:100852689-100852711 TAGCGCGCGCGTGCTGGTGGGGG + Intronic
1029496326 7:100896993-100897015 GTGCGCGCGCGCGGCGGTGCGGG + Intergenic
1029537002 7:101162959-101162981 CGGCGGGGGCGCGCGGGGGCGGG + Exonic
1030018088 7:105244610-105244632 CGGCCCTGGCGCGCTGGGGCTGG - Intronic
1031025197 7:116672252-116672274 CGGCCCGGGCGCGTTGGGGCCGG - Intergenic
1034951087 7:155297644-155297666 CGGCCCGCGCGCACTCGGGCGGG - Intergenic
1036032669 8:4991538-4991560 CGCCGCGCGCGCCCGGGTGGCGG - Intronic
1036562068 8:9906318-9906340 CGGCGCGCGTGGGCTCGGGCAGG - Intergenic
1036665197 8:10733108-10733130 AAGCGAGCGCGCCCTGGTGCAGG + Intronic
1036930614 8:12951998-12952020 CGGAGGGCGCGCGGGGGTGCGGG - Intronic
1037947797 8:22999968-22999990 CGGCGCCGCCGCGCTGCTGCTGG - Intronic
1038008839 8:23457699-23457721 CGGAGCGCGCCCGCTGGCGGCGG + Intergenic
1039053162 8:33513081-33513103 CGGCGGGCGCGAGCCGTTGCAGG - Exonic
1041028607 8:53712526-53712548 GGGCGCCCGGGCGCGGGTGCGGG + Intergenic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1046055241 8:109071147-109071169 CAGCGCTCGCGGGCCGGTGCAGG - Intergenic
1047499327 8:125429974-125429996 CGGCGCGCGCGCCCTCCCGCAGG - Intergenic
1048972873 8:139655025-139655047 CGGGGGGCGGGCGCTGGGGCAGG + Intronic
1049109607 8:140635143-140635165 CGGGGCCCGCGGGCTGGGGCCGG - Intronic
1049558572 8:143296182-143296204 CGCTGTGCGCCCGCTGGTGCCGG - Exonic
1049558589 8:143296266-143296288 CCGTGTGCACGCGCTGGTGCCGG - Exonic
1049558643 8:143296518-143296540 CCGTGTGCACGCGCTGGTGCTGG - Exonic
1050388157 9:5111709-5111731 CCACGCGCTCGTGCTGGTGCAGG - Intronic
1050552130 9:6757949-6757971 CGGCGCGCGCGCCCTCGCGCAGG + Intronic
1051170085 9:14313243-14313265 CGGAGCGCGGGCGCTGGGCCGGG - Intronic
1054820629 9:69517042-69517064 GGGCTCGCCCGCGCTGGTGGCGG + Exonic
1055611581 9:78030936-78030958 CCGCGCGCCCGCGCGGGTGAAGG + Intronic
1056475231 9:86946551-86946573 CGAGGCGTGCGCGCCGGTGCTGG - Exonic
1057245607 9:93451884-93451906 GGGGGCGCGGGCGCGGGTGCGGG - Exonic
1057869751 9:98708820-98708842 CGGCGCCCGCGCAATGGCGCCGG + Exonic
1058436498 9:104968543-104968565 CGGCGCGCATGCGCGGCTGCCGG + Intergenic
1058923595 9:109640759-109640781 CGCCGCGCGCGAGGTGGAGCTGG - Intergenic
1060700764 9:125747429-125747451 CGCCGCGCGCGGGCGGGAGCGGG - Exonic
1060996552 9:127877535-127877557 GGGCGGGGGCGTGCTGGTGCGGG - Intronic
1061129777 9:128702521-128702543 CGCCGCGCGCCCGCGGGAGCCGG - Exonic
1203471248 Un_GL000220v1:116351-116373 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203479069 Un_GL000220v1:160323-160345 CGGCGCGCGCGGGGTGGGGCGGG - Intergenic
1185452643 X:290941-290963 AGGCGGCCGGGCGCTGGTGCAGG + Intronic
1186669961 X:11758204-11758226 CGGAGCGCGCGCGGTGGGGGAGG - Exonic
1187675774 X:21715316-21715338 GCGCGCTCGCGCGCTGGTGGGGG + Intronic
1190862636 X:54358651-54358673 CAGTGCGCGCGCGCGGGGGCTGG + Intergenic
1195954888 X:110318182-110318204 GGGCGCGCGCGCGCCGCTCCCGG + Exonic
1198388022 X:136147328-136147350 CGGGGCGCGCGCGCGGGAGACGG - Intergenic
1198807200 X:140504232-140504254 CGGCGCGTACTCGCTGGTGCAGG - Exonic
1200058754 X:153474731-153474753 GGGGGCGCGGGCGCTGGCGCGGG + Intronic