ID: 915152347

View in Genome Browser
Species Human (GRCh38)
Location 1:153844189-153844211
Sequence CTGAGGAAACTATCCAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915152343_915152347 22 Left 915152343 1:153844144-153844166 CCCCTCAAATACTGAGGATATCA 0: 1
1: 0
2: 3
3: 15
4: 159
Right 915152347 1:153844189-153844211 CTGAGGAAACTATCCAAGACTGG 0: 1
1: 0
2: 5
3: 32
4: 171
915152344_915152347 21 Left 915152344 1:153844145-153844167 CCCTCAAATACTGAGGATATCAG 0: 1
1: 0
2: 1
3: 10
4: 155
Right 915152347 1:153844189-153844211 CTGAGGAAACTATCCAAGACTGG 0: 1
1: 0
2: 5
3: 32
4: 171
915152345_915152347 20 Left 915152345 1:153844146-153844168 CCTCAAATACTGAGGATATCAGA 0: 1
1: 0
2: 2
3: 17
4: 176
Right 915152347 1:153844189-153844211 CTGAGGAAACTATCCAAGACTGG 0: 1
1: 0
2: 5
3: 32
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915152347 Original CRISPR CTGAGGAAACTATCCAAGAC TGG Intronic
907921208 1:58913968-58913990 GTGAGGAAGCTATCCAAAGCTGG + Intergenic
909907411 1:81215425-81215447 CTGAGCAAACTATCACACACTGG - Intergenic
910135629 1:83965506-83965528 GTAAGGATACTACCCAAGACTGG - Intronic
910785252 1:90990694-90990716 GTGTGGAAACTATCCAAGCAAGG + Intronic
911321773 1:96422383-96422405 CTGAAGAAATTATCCACCACAGG - Intergenic
915152347 1:153844189-153844211 CTGAGGAAACTATCCAAGACTGG + Intronic
916410260 1:164540414-164540436 CTGAGGATCCTATCCAAGGGAGG + Intergenic
916534054 1:165686459-165686481 GTGAGAAAACTACCCAAGACTGG + Intronic
918101418 1:181378616-181378638 GTGAGGAAACTACCCAAGGCTGG + Intergenic
918999106 1:191805150-191805172 CTGAGAAAATTATCCAAAAATGG - Intergenic
923183065 1:231541800-231541822 GTGAGGAAACTACCTAAGGCTGG - Intronic
1063668062 10:8077767-8077789 AGGAGGAAAATATCCAAGGCAGG - Intergenic
1069154495 10:65010248-65010270 CAGAGAAAAATATCCAAGAATGG - Intergenic
1070177411 10:73983723-73983745 GTGAGAAAACTACCCAAGGCTGG - Intergenic
1071380265 10:85052476-85052498 CTAAGGAAAATACCCAAGGCTGG + Intergenic
1072533463 10:96341379-96341401 GTGAGAAAACTACCCAAGGCTGG - Intergenic
1076784664 10:132743819-132743841 CTGAGGACACCCTCCAAGGCCGG + Intronic
1077944862 11:6885774-6885796 CTGAAGAAACTGTCCAAGGCTGG + Intergenic
1077963561 11:7101723-7101745 GTGAGGAAGCTATCTGAGACTGG - Intergenic
1078116687 11:8459857-8459879 ATGAGGAAACTACCCAAAGCTGG + Intronic
1078324779 11:10370600-10370622 CAGAGCAAATTATCCAAGACAGG - Intronic
1083010173 11:59389264-59389286 CTGATGAAACTATACAATCCAGG - Intergenic
1085765734 11:79280203-79280225 CTGTGGAAACTACAGAAGACTGG - Intronic
1086392183 11:86376343-86376365 ATGAAGATACTATCCCAGACTGG + Intronic
1087562613 11:99809966-99809988 CTGAGGAAATTAGCAAAGGCAGG - Intronic
1089171976 11:116518391-116518413 CAGAAGAAACCAACCAAGACTGG - Intergenic
1089178321 11:116564004-116564026 GTGGGGAAATGATCCAAGACAGG - Intergenic
1090293550 11:125567227-125567249 CAGAGGAAAACATGCAAGACAGG + Intergenic
1091617788 12:2062785-2062807 CTGAGGAAATATTCCAAGAATGG - Intronic
1092095580 12:5839304-5839326 GTGAGGAAAGTACCCAAGACTGG + Intronic
1092765169 12:11846581-11846603 CGAAGGAAACCATCCAAGAGTGG + Intronic
1094441353 12:30480491-30480513 CTAAAGATACTACCCAAGACTGG - Intergenic
1095248779 12:39954428-39954450 GTGAGGAAACAACCCAAGACAGG + Intronic
1096173990 12:49499492-49499514 ATAAAGAAACTACCCAAGACTGG - Intronic
1096711991 12:53464386-53464408 CTGTGGGAACAATCCATGACAGG - Intronic
1099562508 12:84195544-84195566 TTGAGGAAAGAATACAAGACTGG - Intergenic
1101602082 12:106219024-106219046 TTTAGAAAACTATCCAAGGCTGG - Intergenic
1103312556 12:120022978-120023000 GTGAGCAAACTATTCAGGACTGG + Intronic
1106767843 13:32933252-32933274 TTGAGGGAACTTTCCAAGGCAGG - Intergenic
1107670455 13:42741471-42741493 CTTATAAAACTATCCAAGCCTGG + Intergenic
1107839553 13:44441878-44441900 GTGAGGAAACTACCCGAGGCTGG + Intronic
1107896017 13:44964694-44964716 GTCAGGAAACTATCCAAGGTTGG + Intronic
1108928491 13:55784642-55784664 CTGATGAATCTATCCACTACAGG - Intergenic
1110232039 13:73177144-73177166 CAGAAGAAACTAGCCAGGACCGG - Intergenic
1110492270 13:76123697-76123719 ATGAAGAAAATATCCCAGACTGG - Intergenic
1114126526 14:19733365-19733387 CTGAGGAAAATCTTCAGGACTGG - Intronic
1117073032 14:52073217-52073239 CTGAGGATCCAATCCAAGAAGGG - Intergenic
1117954561 14:61112647-61112669 CTGAGGAGACGCTCCAGGACAGG - Intergenic
1120222873 14:81754852-81754874 ATGAGGAAACTAGTCAAGACTGG + Intergenic
1123570036 15:21595602-21595624 CTGAGGAAAATCTTCAGGACTGG - Intergenic
1123606148 15:22030922-22030944 CTGAGGAAAATCTTCAGGACTGG - Intergenic
1124181032 15:27474690-27474712 TTGAGAAAACTATGGAAGACAGG + Intronic
1124639758 15:31390300-31390322 CTCAAGTAACTATCCAAGAAAGG + Intronic
1129423520 15:75449549-75449571 CTAAGGCAACTCTCCAATACAGG + Intronic
1129811896 15:78517912-78517934 GTGAGGAAACTACTCAAAACTGG - Intronic
1131835006 15:96381589-96381611 CAGAGCCAACGATCCAAGACAGG - Intergenic
1202978386 15_KI270727v1_random:322694-322716 CTGAGGAAAATCTTCAGGACTGG - Intergenic
1133339742 16:5028539-5028561 CGGAGGAACCTATAAAAGACTGG - Intronic
1137846278 16:51691307-51691329 GTGAGGAAACTACGCAAGGCTGG + Intergenic
1138326994 16:56182344-56182366 ATGAGGAAACTGTTAAAGACTGG - Intergenic
1138465630 16:57187365-57187387 CTCAGAGAACTATACAAGACAGG - Intronic
1139677433 16:68534116-68534138 CTGAGGAAATTATCCACAAATGG - Intronic
1140333517 16:74081290-74081312 CTGAGGAGACTACCCAAGGCTGG + Intergenic
1143719078 17:8797826-8797848 CTTAGGAAACTGTCCAGGACGGG - Exonic
1143741876 17:8960470-8960492 CTGAGGACACTGAGCAAGACAGG - Intronic
1143969311 17:10783323-10783345 GTGAGGAAACTACCCAAGGCTGG - Intergenic
1145947762 17:28790540-28790562 CTGAAGAAACTGTTCCAGACTGG + Intronic
1146309371 17:31755351-31755373 GTGAGGAAACTGGCCCAGACAGG + Intergenic
1147808298 17:43148059-43148081 GTGAGGAAACTGCCCAAGACAGG - Intergenic
1148169885 17:45509973-45509995 GTGAGGAAACTGCCCAAGACAGG - Intergenic
1148279324 17:46335839-46335861 GTGAGGAAACTGCCCAAGACAGG + Intronic
1148301541 17:46553694-46553716 GTGAGGAAACTGCCCAAGACAGG + Intronic
1149028855 17:52061817-52061839 ATAAGGATACTACCCAAGACTGG - Intronic
1149401328 17:56299334-56299356 CTGGGGAGACTATCCAAGGGTGG - Intronic
1149536993 17:57440898-57440920 CTGAGGAAACTAGGCCAGAGGGG + Intronic
1149742512 17:59059979-59060001 CTGAGGAAACTACCTGAGATTGG - Intronic
1150400966 17:64855571-64855593 GTGAGGAAACTGCCCGAGACAGG - Intronic
1152045335 17:77931403-77931425 CCGAGGAAACTTCCCAAGGCGGG - Intergenic
1153068076 18:1070267-1070289 GTGAGGAAACTATCTGAGATTGG - Intergenic
1155514620 18:26612105-26612127 GTGAGGAAACTATCCAAGTCAGG - Intronic
1158727042 18:59983151-59983173 ATGAAGATACTACCCAAGACTGG - Intergenic
1159932322 18:74326410-74326432 GTGAGGAAGCTACCCAAGGCTGG - Intronic
1166025386 19:40078661-40078683 CTGAGGATAGTATCCTTGACTGG - Intronic
1167230699 19:48281229-48281251 CTGATGAAACTATCACAGATGGG + Intronic
1167255563 19:48426025-48426047 CTGAGGAAAATAAGCCAGACAGG - Intronic
1168467590 19:56616608-56616630 GTCAGGAAACTACCCAACACAGG - Intronic
925607354 2:5672996-5673018 CTGAGGACACAATCCAACCCAGG - Intergenic
927037431 2:19193613-19193635 CTGAGGAAAAAACCCAAGGCTGG - Intergenic
928972490 2:37045588-37045610 ACAAGGAAACTACCCAAGACTGG - Intronic
929937621 2:46305468-46305490 CTGAGGAATCTTTCCAAGTTCGG - Intronic
931930095 2:67122231-67122253 CTGAGGAAGCTACCCAAGGCTGG - Intergenic
932288878 2:70558549-70558571 CTGAGGAAAGTAGCAAAGATAGG - Intergenic
935637338 2:105259501-105259523 CTGAAGCAACCATCCAAGAAGGG + Intergenic
936072237 2:109378856-109378878 ATGAGGGAACTATCCAGCACTGG - Intronic
938757119 2:134391230-134391252 TTGAGGAAACCATCCAAAAGAGG + Intronic
940538422 2:154978300-154978322 ATGAAGAAACTATGCAAGCCTGG + Intergenic
940734694 2:157437402-157437424 CAAAGGAAGCTATACAAGACTGG + Intronic
941882184 2:170492266-170492288 ACGAGGAAACTATCCAAGACTGG - Intronic
943933316 2:193882957-193882979 ATAAGGATACTACCCAAGACTGG + Intergenic
944168181 2:196745327-196745349 GTGAGGAAACCATCTAAGGCTGG + Intronic
946709693 2:222493176-222493198 ATGAAGATACTATCCAAGACTGG + Intronic
947366756 2:229404230-229404252 ATGAAGATACTACCCAAGACTGG + Intronic
948154305 2:235769079-235769101 CTGAGAAAAGGATCCAAGGCTGG - Intronic
948838771 2:240639012-240639034 TGGAGGAAATTATCCAAGAAGGG - Intergenic
1169155071 20:3322829-3322851 CTGGGGAAAGTATCCAAAATAGG - Intronic
1172365987 20:34349855-34349877 CTGAGGCAACTATCCCAGAGTGG - Intergenic
1175806569 20:61832449-61832471 GTAAAGATACTATCCAAGACTGG + Intronic
1176311525 21:5153298-5153320 CTGAGGAAGCCTCCCAAGACAGG + Intronic
1177222254 21:18209738-18209760 ATGAGGAATCTTTCCAGGACTGG + Intronic
1177272332 21:18865657-18865679 ATGAAGAAAATACCCAAGACTGG - Intergenic
1178233076 21:30809719-30809741 CTGATGACACTATCCAACAAAGG - Intergenic
1179845525 21:44108737-44108759 CTGAGGAAGCCTCCCAAGACAGG - Intronic
1184617902 22:45650539-45650561 CTGAGGCACCCATCCAAGGCTGG - Intergenic
1184763184 22:46557198-46557220 CTGAGGAACCTAACCAAAGCTGG + Intergenic
1185359528 22:50397291-50397313 CTGAGTAAACAATCCAGGTCAGG + Intronic
951251261 3:20396494-20396516 GTGAGGAAACTAACCAAGGCTGG - Intergenic
954804025 3:53204935-53204957 CTGAGGAAACCACCCAAGGCTGG + Intergenic
955048402 3:55383744-55383766 CTGAAAGAACTATCCAAGAGTGG + Intergenic
955893064 3:63670717-63670739 CTGAAGCTACTATACAAGACAGG - Intronic
956190186 3:66600701-66600723 AGGAGGGAACTATACAAGACAGG - Intergenic
958688664 3:97432612-97432634 ATGAAGATACTACCCAAGACTGG + Intronic
959507554 3:107172414-107172436 ATAAGGATACTACCCAAGACTGG - Intergenic
960926820 3:122802488-122802510 GTGAGGAAATTAGCCAAGACTGG + Intronic
963426241 3:145129250-145129272 CTGAGGAAATAATCATAGACAGG - Intergenic
965957776 3:174391266-174391288 CTGGGGAAAATATTCAAAACAGG - Intergenic
966490574 3:180523995-180524017 ATAAAGATACTATCCAAGACTGG + Intergenic
970167228 4:13251640-13251662 GTGAGGAAACTATCCAAGGCAGG + Intergenic
971711006 4:30112729-30112751 CTGTAAAAAATATCCAAGACTGG + Intergenic
972699057 4:41476323-41476345 CTAAGGAAACAATGCAAAACTGG - Intronic
973706039 4:53581466-53581488 ATGAAGAAATTACCCAAGACTGG + Intronic
974227994 4:59073094-59073116 GTGAGGAAACTACTCAAGACTGG + Intergenic
976370231 4:84279358-84279380 ATGAGGATACCATCCAAGATGGG - Intergenic
976632743 4:87255752-87255774 CTCAAGAAAGTATCAAAGACAGG + Intergenic
977752781 4:100629521-100629543 CTGAGGGATCTATCCAGTACAGG - Intronic
978028779 4:103912318-103912340 GTGAGGAAACTAACCAAAGCTGG - Intergenic
981837715 4:149075233-149075255 GTGAGGAAATTATCCAAGGCTGG - Intergenic
982167506 4:152628103-152628125 CAGAGGAAATTATCCAAAGCTGG + Exonic
982927432 4:161356120-161356142 ATGTTGAAACTATCCAGGACAGG + Intergenic
986783809 5:11091848-11091870 CTGAGGCAAATACCCAAGGCTGG - Intronic
987229525 5:15879029-15879051 CCCAGAAAACTATCCAAGTCTGG - Intronic
987499082 5:18682388-18682410 GTAAAGAAACTATCCAAGACTGG - Intergenic
987815257 5:22892431-22892453 CTGAGGAAAGTCACCAGGACAGG - Intergenic
988306492 5:29500165-29500187 CAGAGGCAACTTTCTAAGACAGG - Intergenic
990744056 5:58940543-58940565 GTGAGGAAACTACCCATGACTGG - Intergenic
991292693 5:65048099-65048121 CTCTGGAAAGTATCCAAGTCAGG - Intergenic
991486345 5:67140919-67140941 GTGAGGAAACTACCCAAAAAGGG - Intronic
995342907 5:111080014-111080036 ATGAGAAAACTACCCAACACTGG + Intergenic
995351451 5:111180875-111180897 GTGAGGAAACTACCTAAGTCTGG - Intergenic
997034000 5:130165145-130165167 ATGAGGCATCTTTCCAAGACGGG - Intronic
999062215 5:148647956-148647978 CTGAGGAAACAAACCAAGACAGG - Intronic
999456893 5:151724421-151724443 CTGGGGAACCCATCCCAGACTGG - Intergenic
1001545811 5:172569977-172569999 CTGAGGGAACTATTCAAGGCAGG + Intergenic
1003255691 6:4472913-4472935 CTGAGCAAACTGTCCTAGGCTGG - Intergenic
1003955301 6:11158664-11158686 GTGAGGAAGCAATCAAAGACTGG + Intergenic
1004305349 6:14497101-14497123 GTGAGGAAGCTACCCAAGAATGG - Intergenic
1004436812 6:15603885-15603907 GTGAGGAAACTATCCAAGGCAGG - Intronic
1005981216 6:30838461-30838483 CCGGGGAAACTGTCCAAGACAGG - Intergenic
1006571380 6:35007968-35007990 CTGAGAAAACAATCCAAAACTGG - Intronic
1006748365 6:36361009-36361031 CTGTGCAAACTTTCCAAGCCAGG + Intronic
1007021692 6:38527657-38527679 GTAAAGATACTATCCAAGACTGG - Intronic
1007072586 6:39048351-39048373 CTGAGGATACTTTCCAGGAGTGG + Intergenic
1007116473 6:39346617-39346639 CTGTGTAAACCATCCAAGACAGG - Intronic
1013864115 6:114673870-114673892 ATGAGGACACTTTCCCAGACAGG + Intergenic
1013955833 6:115839223-115839245 CTGAGGAAACCAGTCAAGGCAGG - Intergenic
1014159779 6:118154548-118154570 TTGAGGAAACTCTGGAAGACTGG - Exonic
1014169764 6:118265911-118265933 CTGGATACACTATCCAAGACAGG - Intronic
1018622315 6:165742426-165742448 CTGAGCAAAGTATCCATGAGTGG + Intronic
1019261764 7:85954-85976 CTGAGACAACTTTCCAGGACAGG - Intergenic
1021105499 7:16634596-16634618 ATGTGGAAACTACCCAAGCCTGG + Intronic
1021531119 7:21646599-21646621 GTGAGGAAACTACCCAGGCCTGG + Intronic
1022875599 7:34525343-34525365 TTCAGGAAACTCTCAAAGACAGG - Intergenic
1022973976 7:35540299-35540321 CTGAGGGAAGAATCCAAGACAGG + Intergenic
1030145473 7:106349670-106349692 CTGAGCAAATTAGCCAAGGCTGG + Intergenic
1030221297 7:107101899-107101921 ATGAGGAAACTAAACAAAACTGG - Intronic
1030997916 7:116380934-116380956 ATGAAGAAAATACCCAAGACTGG + Intronic
1031070119 7:117152905-117152927 AACAGGAAACTATACAAGACAGG - Intronic
1031421737 7:121561070-121561092 GTGAGAAAACTACCCAAAACTGG - Intergenic
1033833649 7:145283005-145283027 GTGAGGAATCTTTCCAGGACTGG + Intergenic
1033925420 7:146453196-146453218 TTGAGGAAACTATCTGAGGCAGG + Intronic
1037424992 8:18746088-18746110 CAGAGGAAAGTATGCCAGACAGG - Intronic
1038163874 8:25066121-25066143 TTGAGAAAACTATGCAAGAAAGG + Intergenic
1038520706 8:28229920-28229942 GTGATGAAACTATCCAGGGCTGG + Intergenic
1038748398 8:30274002-30274024 ATGAAGATACTACCCAAGACTGG - Intergenic
1042014458 8:64292661-64292683 ATGAGGAAAGTAGCCAAGGCTGG - Intergenic
1043019809 8:74985944-74985966 CCCAGGAAAATCTCCAAGACAGG - Exonic
1043031952 8:75146292-75146314 CTGAGGAAACACACCAAGAGAGG - Intergenic
1044298423 8:90555477-90555499 CTGAGAAACCAATCCAAGAAAGG - Intergenic
1050006350 9:1135001-1135023 ATGGGGAAACTATACAACACTGG - Intergenic
1050721006 9:8589681-8589703 ACCAGGATACTATCCAAGACAGG - Intronic
1051120043 9:13742835-13742857 CTAAGGAATTTATCCAATACTGG - Intergenic
1053176426 9:35928418-35928440 CTAAGGAAATAATCAAAGACTGG + Intergenic
1053262527 9:36681416-36681438 CTTAGGTAACTATCCAGGAATGG + Intergenic
1055178548 9:73352270-73352292 GTGAGGGAACTATCCAAGCCTGG - Intergenic
1059539527 9:115116908-115116930 CACAAGAAACAATCCAAGACTGG + Intronic
1060486727 9:124052419-124052441 CTGAGGAAACCACCCAGGAAAGG + Intergenic
1185820150 X:3195040-3195062 ATAAGGATACTATCCTAGACTGG - Intergenic
1187263446 X:17708722-17708744 CTGAGGAAACTATGAGAGGCAGG + Intronic
1189742395 X:44133417-44133439 GCAAGGAAACTACCCAAGACTGG - Intergenic
1190575766 X:51836530-51836552 CAGAGGCAACTACCCAAGGCAGG - Intronic
1190703378 X:53005093-53005115 GTGAGGAAACTACCCAAGCCTGG + Intergenic
1193678079 X:84482328-84482350 ATAAAGAAACTTTCCAAGACTGG + Intronic
1194495969 X:94616892-94616914 ATAATGATACTATCCAAGACTGG + Intergenic
1195765090 X:108287658-108287680 GTAAGGAAACTAACCTAGACTGG - Intronic
1196501087 X:116383337-116383359 ATGAGGAAGCTAACCAAGACTGG - Intergenic
1197487538 X:127072688-127072710 CTGTGGAAACTATACAGGCCAGG - Intergenic
1198283532 X:135167634-135167656 CAGAGGAAACAATCAAAGAGTGG + Intronic
1200371832 X:155734911-155734933 CTGAGGAAACTAGAAAAGAAAGG - Intergenic
1201014479 Y:9586206-9586228 GTGAGGAAACTAACCGAGGCTGG + Intergenic
1201923636 Y:19261367-19261389 CTGAGGAGACTCTCTGAGACAGG + Intergenic