ID: 915153598

View in Genome Browser
Species Human (GRCh38)
Location 1:153855795-153855817
Sequence CCAGCTACTCCCAGTCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915153598 Original CRISPR CCAGCTACTCCCAGTCCCAG AGG (reversed) Intronic
900768300 1:4520252-4520274 CTAGCTCCTCACAGCCCCAGAGG + Intergenic
901134697 1:6985295-6985317 CCAGCTCCTCCCATTCACAGTGG - Intronic
901465846 1:9420557-9420579 TCTGCTTCTCCCACTCCCAGGGG + Intergenic
902579937 1:17402000-17402022 CCAGGTCCTACCAGTCCCAAGGG - Intergenic
903736033 1:25530412-25530434 CCAGCCATTCCCAGAGCCAGCGG + Intergenic
904206603 1:28859484-28859506 CCAGCTATTCCCATTCCCATTGG - Intronic
904306631 1:29594204-29594226 CTGGGTACTGCCAGTCCCAGAGG - Intergenic
905506383 1:38483140-38483162 CCATCTACTCTCCATCCCAGGGG + Intergenic
906147294 1:43567608-43567630 CTATCTGCTGCCAGTCCCAGGGG - Intronic
908434667 1:64093309-64093331 CGAGCTACCCCCAGAGCCAGAGG - Intronic
909329678 1:74396359-74396381 CCAACTTCTCCCTGTCCCACAGG - Intronic
909875759 1:80800383-80800405 CCCACTACTCCCAGTGCTAGTGG + Intergenic
915153598 1:153855795-153855817 CCAGCTACTCCCAGTCCCAGAGG - Intronic
916868702 1:168888443-168888465 CCAGGTACTCCCACTCTTAGGGG + Intergenic
919977673 1:202623350-202623372 CCAGCTGCTCCCAGCCCAGGGGG + Intronic
920947589 1:210544205-210544227 CCAGCTACATCCCCTCCCAGTGG - Intronic
921846647 1:219890248-219890270 CCAGCTCCTCCTTGTCCCTGTGG - Intronic
922617853 1:226973670-226973692 CCAGCTGCCCCCAGCCTCAGGGG - Intronic
924477914 1:244397521-244397543 CCAGTGTCTCCCAATCCCAGTGG - Intergenic
1069066480 10:63947224-63947246 CCAGCTCCTCCTTGTCCCTGTGG + Intergenic
1069521434 10:69124420-69124442 CCAGCTTTTCCCAGACCCAGGGG - Intronic
1072240432 10:93490497-93490519 CCAGCTTCTGCCAGTCCAATTGG - Intergenic
1073514823 10:104066864-104066886 CCAACTTCTCCCTGTCCCATAGG - Intronic
1074421104 10:113309510-113309532 CATGCTCTTCCCAGTCCCAGAGG + Intergenic
1074442553 10:113491501-113491523 CCAGTAACTCCCACTCCCATTGG - Intergenic
1074997668 10:118771842-118771864 ACAGCTACTCCCTGTCCCTATGG + Intergenic
1075180312 10:120205060-120205082 CCAGCTCCTCGCACACCCAGTGG + Intergenic
1076283314 10:129269676-129269698 CCAGCAACTCTGAGTCTCAGAGG + Intergenic
1076478375 10:130767988-130768010 CCAGCTCCTCCCAGTCAAGGTGG - Intergenic
1076539484 10:131205048-131205070 CCAGCCTCTCCCAGACCAAGCGG + Intronic
1076699122 10:132260990-132261012 ACAGCTTCCCCCAGCCCCAGGGG - Intronic
1077183525 11:1226763-1226785 CCAGCTACGCCGAGGCCTAGTGG + Exonic
1081482537 11:43503129-43503151 GCAGTTACTCCCAGGCCCTGTGG + Intergenic
1081632733 11:44700809-44700831 CCAGCAATCCCCAGGCCCAGGGG + Intergenic
1084268366 11:68016506-68016528 TCAGCCCCTCCCAATCCCAGTGG + Intronic
1084492552 11:69486684-69486706 GGAGCCTCTCCCAGTCCCAGGGG + Intergenic
1084493151 11:69489122-69489144 CCAGCTCCCCCCAATCCGAGGGG - Intergenic
1084676466 11:70638292-70638314 CAAGCTACTCCCAGTGACAGAGG + Intronic
1084956160 11:72692741-72692763 ACAGCTACTCACGGTCTCAGGGG + Exonic
1089376849 11:118000523-118000545 CCAGCTCATGCCAGCCCCAGAGG + Exonic
1090247507 11:125226919-125226941 CCAGAGCCTCCCAGCCCCAGCGG - Intronic
1090332042 11:125939946-125939968 GCAGCTACTCCCATTCACAGGGG - Intergenic
1090767080 11:129885404-129885426 CCAGCTACCCCAAGTGCCCGAGG + Intronic
1091397739 12:163958-163980 CCTGCTCCTCCCAGGCCCTGGGG - Intronic
1091541968 12:1470170-1470192 CCAGTTTCTCCCTGTCACAGTGG + Intronic
1093505740 12:19863841-19863863 CCAGGTACTCTGGGTCCCAGAGG - Intergenic
1098758160 12:74390505-74390527 GCAGATACTCCCAGCCCCTGGGG - Intergenic
1100437595 12:94585736-94585758 GAAGCTTTTCCCAGTCCCAGTGG + Intronic
1102585265 12:113918557-113918579 CCAGCTAGCCCCACTCCCCGGGG - Intronic
1103435033 12:120918633-120918655 CCAGCTACTGCCTTTCACAGGGG - Intergenic
1104650391 12:130527107-130527129 CCAGGTCCTCCAAGTCCCAACGG - Intronic
1104874728 12:132026118-132026140 CCACACACTCCCACTCCCAGGGG - Intronic
1104917225 12:132271996-132272018 CCAGCCACTGCCAGGGCCAGAGG + Intronic
1104919921 12:132285359-132285381 CCAGTCGCTCCCAGGCCCAGAGG + Intronic
1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG + Exonic
1106049135 13:26174539-26174561 CCAGCTACTCAGAGGCCCAGAGG + Intronic
1107196289 13:37656429-37656451 CTGGCAACTCCCAGCCCCAGTGG + Intronic
1107675297 13:42790180-42790202 GCAGCTCATCCCAGTCCCACTGG - Exonic
1108622196 13:52195404-52195426 CCAGCTACTCAGATTCCCCGCGG + Intergenic
1110413650 13:75229418-75229440 CCAGCTACTGCTTGTGCCAGTGG - Intergenic
1113520154 13:110934823-110934845 CCAACTTCTCCCAGTCCCACAGG - Intergenic
1114503614 14:23190915-23190937 TCAGCTACTACCAGGCCCTGAGG - Intronic
1115383697 14:32770579-32770601 CCAGGCACTCCCACTGCCAGAGG + Intronic
1116752133 14:48899647-48899669 CCAGCTAGTTCCAGTCACCGAGG + Intergenic
1117463757 14:55972316-55972338 CCAGCTGCTCCCCTTCACAGGGG - Intergenic
1119415351 14:74465994-74466016 GCAGCTACTGCCAGTCTCATAGG + Intergenic
1121602738 14:95218155-95218177 CCACCTTCTCCCAGCCGCAGAGG - Intronic
1122975518 14:105169145-105169167 CGCGCTCCTCGCAGTCCCAGAGG + Intergenic
1123133485 14:106007012-106007034 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123135870 14:106026985-106027007 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123165228 14:106319690-106319712 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123583506 15:21737458-21737480 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1123620156 15:22180061-22180083 CCAGCCAGCCCCACTCCCAGAGG + Intergenic
1124475001 15:30025625-30025647 CCAGCTACTCCCAGATCTGGGGG - Intergenic
1124898252 15:33797713-33797735 CTTGCTACTCACAGTCCCTGTGG + Intronic
1125603552 15:40928090-40928112 CCGGCTTCTCCCAGTCTCAGGGG - Intergenic
1125674426 15:41494675-41494697 CCCGCTTCGCCCAGTCCCCGCGG - Intronic
1127087287 15:55436497-55436519 CCAGCTAATCTGAGTCTCAGAGG - Intronic
1127823895 15:62686295-62686317 CCAGGTACTATCACTCCCAGTGG - Intronic
1128187033 15:65651126-65651148 CTAGGGCCTCCCAGTCCCAGTGG - Intronic
1128775404 15:70316444-70316466 CCTGCAGGTCCCAGTCCCAGGGG + Intergenic
1129241934 15:74257056-74257078 CCAGCAGCTCCCAGTCCCTGAGG - Intronic
1129772909 15:78214064-78214086 CCAGCTCCCCCCATTCCCACAGG + Intronic
1131153163 15:90059521-90059543 CCAGCCACTCTGACTCCCAGAGG + Intronic
1132079136 15:98850296-98850318 CCAGCCACTCACAGACACAGAGG + Intronic
1132611003 16:816325-816347 TCACCTCCTCCCAGTGCCAGGGG - Intergenic
1133092291 16:3413896-3413918 CCAGCACGTCCCAGGCCCAGAGG - Intronic
1133860692 16:9592186-9592208 CCAGGTACTCAAAGCCCCAGGGG + Intergenic
1134193502 16:12140415-12140437 CCAGCCACCCCCAGCTCCAGGGG - Intronic
1137692760 16:50440994-50441016 CAAGCTCCTCCCAGCACCAGGGG - Intergenic
1139062039 16:63264030-63264052 CCAGGTACCCACAATCCCAGAGG - Intergenic
1139249398 16:65480453-65480475 CCAGCTGCTGCCTGTCCAAGCGG + Intergenic
1139444996 16:66992175-66992197 CCAGCTCCTCCCAAGTCCAGTGG + Intronic
1141336247 16:83158153-83158175 CCAGGTACTCCCACTCCCCCCGG + Intronic
1141568391 16:84918917-84918939 CCAGCTTCTCTCCATCCCAGTGG - Intronic
1141802792 16:86322579-86322601 GCAGCTTCTACCAGTCTCAGCGG + Intergenic
1142963734 17:3567596-3567618 CCATCTCCTCCCTGCCCCAGCGG + Intronic
1143106211 17:4531738-4531760 CCAGGGGCTCCCAGTCCCGGGGG + Intronic
1143237668 17:5417350-5417372 CCAGCTACTTCCAGGCGCTGAGG + Intronic
1145011729 17:19372138-19372160 CCCGCTCCGCCCAGTCCCTGCGG - Intronic
1145833847 17:27938830-27938852 CCAGCTACTTCCAGGCGAAGTGG + Intergenic
1145981381 17:29014051-29014073 CCAGCTCATACCAGTCACAGGGG + Intronic
1147544782 17:41392968-41392990 CCAGCTGTTCACAGTGCCAGGGG + Intronic
1147566046 17:41536988-41537010 CCAGCTCCTCTCAGTTCCATTGG + Intergenic
1148733370 17:49851228-49851250 CCAGCTCCGCCCGGTCCCCGCGG + Intergenic
1150074532 17:62181242-62181264 CTAGCTGCTACCAGTCCCACAGG - Intergenic
1150092400 17:62339263-62339285 CCAGCTACTCCGAGGGCCTGGGG + Intergenic
1151007386 17:70453366-70453388 CCAGATTCTCCAAGTCCAAGTGG + Intergenic
1152385474 17:79971773-79971795 CCAGCAGCTCACAGTCCAAGTGG - Intronic
1152426958 17:80223197-80223219 CCGGCTCCACCCAGTCCCAGAGG - Intronic
1152640774 17:81448331-81448353 CCAGGAGCTCCCAGTCCCATAGG - Intronic
1152697024 17:81802692-81802714 CCAGCCATTCCCCCTCCCAGGGG - Intergenic
1153291854 18:3509506-3509528 GCAGCTGCACCCAGTCCCAAAGG - Intronic
1154078861 18:11234628-11234650 CCAGGTAGTGCCAGGCCCAGTGG + Intergenic
1154503003 18:15005755-15005777 CCTGCTTGTCCCAGTCCCATGGG - Intergenic
1155490715 18:26398984-26399006 CCACCAACTCCCAGCTCCAGAGG - Intergenic
1161975896 19:7607648-7607670 CCAGCTCCTCCCAGCCCCAAGGG - Intronic
1162412174 19:10513110-10513132 CCAGCTAAGCCCAGACCCCGTGG - Exonic
1163009157 19:14413846-14413868 CCAGCTTCTCCCACTCTCTGTGG + Intronic
1166226562 19:41399372-41399394 ACAGCTGATCTCAGTCCCAGGGG + Intronic
1166842154 19:45704194-45704216 CCAGATTCTTCCAGACCCAGTGG + Intergenic
1167345699 19:48944416-48944438 CCCGCTGCCCCCAGTCCCAAAGG + Exonic
1167468057 19:49660627-49660649 CCAGGAACTCCAACTCCCAGAGG - Intronic
1168104257 19:54156923-54156945 CCAGCTACCCCCAGGGCGAGGGG - Exonic
925637331 2:5952819-5952841 CCAGTTTATCCCAGTCACAGGGG - Intergenic
926216486 2:10908731-10908753 TCAGCAAATCCCAGGCCCAGTGG - Intergenic
926936092 2:18087768-18087790 CCAGCTCCTCCCTGTCCCACGGG + Intronic
927719268 2:25372626-25372648 CCAGCTCTTCCCACTCCCGGAGG - Intergenic
929111371 2:38407780-38407802 CCAGCGCCTCCCAGTGCCACTGG - Intergenic
929283987 2:40115075-40115097 CCATCACCTCCCATTCCCAGGGG - Exonic
929536980 2:42789964-42789986 CCAGCGCCTCCCCTTCCCAGAGG - Intronic
930256677 2:49101353-49101375 CCATCTACTCCCAGTTCTGGAGG - Intronic
936445454 2:112591103-112591125 CCAGTTACTCCAATTTCCAGAGG - Intergenic
936505807 2:113104939-113104961 TGAGAAACTCCCAGTCCCAGTGG + Intergenic
938092829 2:128444517-128444539 CCATCTGCTCCCAGTCCCTCAGG + Intergenic
938407301 2:131039692-131039714 CCTGCTCCTGCCAGCCCCAGCGG - Intronic
943627287 2:190214989-190215011 CCAACTCCTCCCTGTCCCATAGG - Intronic
944768780 2:202891259-202891281 CCAGCTACGCCCAGCCCAGGAGG - Intronic
946626605 2:221618859-221618881 CCATCACCTTCCAGTCCCAGAGG + Intergenic
946940069 2:224761103-224761125 CCAGCTACTTGGACTCCCAGTGG - Intergenic
947208846 2:227687139-227687161 CCAGCTGCTACTAGTCACAGGGG + Exonic
947732524 2:232439269-232439291 CCCGCTCCTCCCAGCACCAGGGG - Intergenic
947779940 2:232750399-232750421 CCAGCTGCTCCCTTTCCCAGAGG + Intronic
948057059 2:235016408-235016430 CCAGACACTTCCAGTCACAGAGG - Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171427672 20:25058534-25058556 CCGGCTCCTCCCCATCCCAGAGG - Intronic
1173190197 20:40870076-40870098 CAAGCTTCTACCAGGCCCAGTGG - Intergenic
1173658134 20:44715004-44715026 CCAGCTCCTTCCAGCCCAAGAGG - Exonic
1174454906 20:50642034-50642056 CCGGCTCCTCCCCATCCCAGGGG + Intronic
1174457822 20:50662119-50662141 CCAGCCACTTCCAGACCCACGGG + Intronic
1174471896 20:50767696-50767718 CCGGCTCCTCCCCATCCCAGGGG - Intergenic
1175086328 20:56462134-56462156 CCATGTCCTCCAAGTCCCAGGGG + Intergenic
1175459254 20:59138820-59138842 CAAGCCACTCCAAGTCCCAGTGG - Intergenic
1178747069 21:35263073-35263095 CCAGATTCTCACATTCCCAGGGG - Intronic
1178870401 21:36369471-36369493 CCAGCTACTCCTTGTCACTGAGG + Exonic
1179248234 21:39651384-39651406 CCAGCCACTCCCAGAGCCTGCGG - Intronic
1179664745 21:42903298-42903320 GTAGCTAGTCCCAGTCCCAGTGG + Exonic
1180972959 22:19825076-19825098 CCAGGTCCTCCCTGTCCCATTGG + Intronic
1181311745 22:21948648-21948670 CCAGCAACTGCCAGTGCCTGGGG + Intronic
1181626028 22:24122879-24122901 CCAGGTACACCAGGTCCCAGAGG + Intronic
1184113390 22:42408542-42408564 CCAGGTTCTCCCAGGCTCAGGGG - Intronic
1184181703 22:42832611-42832633 CTAGCTCCTCCCAGTCCCACTGG - Intronic
1184747834 22:46466255-46466277 CCAGCTGCTCCCACTCCGAAGGG + Intronic
1184931364 22:47683577-47683599 CCCCCGACTCCCAGTCCCTGAGG + Intergenic
1184943999 22:47788151-47788173 CCAGCCAGTCCCTGCCCCAGTGG - Intergenic
1185276103 22:49950786-49950808 GCAGCTTCTCCCAGGCCCTGTGG + Intergenic
950464560 3:13145678-13145700 CCAACCACACCCTGTCCCAGAGG + Intergenic
951975476 3:28502502-28502524 TCAGCTCCTCCCACTCCCACTGG - Intronic
953921552 3:46955434-46955456 CCACCTTCTCTCATTCCCAGTGG - Intronic
954136740 3:48585330-48585352 GCAGCAGCTCCAAGTCCCAGAGG - Intronic
954329742 3:49883432-49883454 CCAGAGACTCCCAATGCCAGAGG - Intergenic
954783296 3:53075662-53075684 CCAGCAACTCCCAGTCTTGGTGG - Intronic
954911766 3:54116860-54116882 CCATCTCATCACAGTCCCAGAGG + Intergenic
955679151 3:61482069-61482091 CCAGCTACTCCCAGAGGCTGAGG + Intergenic
957265709 3:77962529-77962551 CCAGCTACTCCCAGCTACTGGGG - Intergenic
957281391 3:78155127-78155149 CCAGGGACTCCCACTCCTAGGGG + Intergenic
961349942 3:126293443-126293465 ACAGCTCCTCCCAGACCCCGAGG - Intergenic
961457608 3:127031940-127031962 CCAGCTAATGGCAGTCCCTGAGG + Intronic
962751280 3:138435984-138436006 CCAGTTACTCTCAGGCCCACGGG + Intronic
963483223 3:145903741-145903763 CCACCTGCTCCCAGGCCCTGAGG - Intergenic
964336734 3:155662590-155662612 CCAAATACCCCCAGCCCCAGTGG + Intronic
964893796 3:161569569-161569591 CCAGCTACATTCAGTCCCAAGGG + Intergenic
968603061 4:1519500-1519522 CCAGCCGCCCCCAGGCCCAGTGG - Intergenic
968620008 4:1599798-1599820 ACAGGCACTCCGAGTCCCAGTGG + Intergenic
968632561 4:1659562-1659584 GCAGCTACTCCCAGTGGCACTGG + Intronic
968810953 4:2799503-2799525 CCAGCAACTTCCTGCCCCAGAGG - Intronic
969306140 4:6327299-6327321 CCAGCCACGCCCTGTCCTAGTGG - Intronic
971457408 4:26857837-26857859 CCGGCTCCTCCCCATCCCAGAGG - Intronic
974730001 4:65851128-65851150 ACACCTACTGCCGGTCCCAGTGG - Intergenic
975373681 4:73617407-73617429 GCAGCGCCTCCCAGACCCAGTGG - Intronic
976658129 4:87510876-87510898 CCAGCCACGCCAAGCCCCAGAGG - Intronic
979024702 4:115554243-115554265 CTACCAACCCCCAGTCCCAGAGG - Intergenic
981675461 4:147338401-147338423 CCACCACCTCCCATTCCCAGTGG + Intergenic
985292308 4:188399112-188399134 CCAGCGACTCCTATTCCAAGTGG - Intergenic
985531455 5:436144-436166 ACAGCTCCTGCCACTCCCAGTGG - Exonic
985769325 5:1799317-1799339 CCAACTCTTCCCAGACCCAGGGG + Intronic
986137112 5:4990661-4990683 CCAGCTGCTCCCACACACAGTGG - Intergenic
990180786 5:53157933-53157955 CCTGCTACTGCCAATCTCAGAGG - Intergenic
990451265 5:55933549-55933571 CCATCTCCTGCCACTCCCAGAGG - Intergenic
993499421 5:88648377-88648399 CCAGCTACTCCCAGCAACTGAGG + Intergenic
994079139 5:95686841-95686863 CCATCTACTCCTAATCCCTGTGG - Intronic
994345421 5:98679895-98679917 ACAGCTCCTGTCAGTCCCAGGGG - Intergenic
994359610 5:98835231-98835253 TGAGCTACTCCCAGCTCCAGGGG + Intergenic
995432577 5:112097952-112097974 CCAGCTACTCCCAGGATCACAGG - Intergenic
996478783 5:123949871-123949893 GCATTTACCCCCAGTCCCAGTGG + Intergenic
999234145 5:150080377-150080399 CCAGGTACTCCTTGGCCCAGTGG - Intronic
999742439 5:154566413-154566435 CCAGCTCGTTCCAGTCCCAGAGG + Intergenic
999953235 5:156672445-156672467 CCAGATGCTCCCAGCCACAGAGG + Intronic
1002421283 5:179150320-179150342 CCAGCTATTCCCCTTCCCACAGG - Intronic
1005822834 6:29611959-29611981 ACAGCTACTCTCTTTCCCAGTGG - Intronic
1006054957 6:31377472-31377494 CGGGCTGCTCCCAGTCCTAGGGG - Intergenic
1008309594 6:49950237-49950259 CCAGCTACTCCCAGAGGCTGAGG + Intergenic
1011242510 6:85287772-85287794 CCACCAACTACCAGTCCCTGGGG + Intergenic
1012399200 6:98831111-98831133 CCAGCTTCTCCCAGGTCCGGAGG - Intergenic
1012464833 6:99505549-99505571 CCAGCTACTCCCAGCCCAGGAGG + Intronic
1013012829 6:106135371-106135393 TCAGGTTCTCCCAGTGCCAGTGG + Intergenic
1013227794 6:108132991-108133013 CCACCTACACCCAGGCCCAGTGG - Intronic
1014151170 6:118057352-118057374 TCTGCCAATCCCAGTCCCAGAGG + Intronic
1014163552 6:118197833-118197855 CCAGCCACTGGCTGTCCCAGTGG - Intronic
1015751907 6:136568939-136568961 CCACCTACCCCCAGGCCAAGGGG + Intronic
1018642861 6:165921038-165921060 CCAGCTCCTCCTATTTCCAGGGG - Intronic
1019594975 7:1854261-1854283 TCAGCCACTCCCAGCCCCAGCGG - Intronic
1020140081 7:5607151-5607173 GCAGCATCTCCCAGCCCCAGGGG - Intergenic
1020863008 7:13518339-13518361 CTAGCTAATCACAGTCCCATAGG + Intergenic
1020900896 7:14002493-14002515 CCAGCTATTCACAGTCGGAGGGG - Intergenic
1022501895 7:30887130-30887152 TCAGCTACCCCCACTCCCTGCGG + Intronic
1024121900 7:46250509-46250531 TCAGCTTCTCACAGTGCCAGAGG - Intergenic
1025106260 7:56174427-56174449 GCAGCCAGGCCCAGTCCCAGAGG - Intergenic
1025998687 7:66544561-66544583 CCAGCTACAGCCAGGCACAGTGG + Intergenic
1026043197 7:66886163-66886185 CCAGCTCCTACCAGGCCCTGTGG - Intergenic
1029117329 7:98244100-98244122 CTGGCTTCTCCCAGTCCCAGGGG + Intronic
1029447557 7:100622347-100622369 CCAGGTGCTCCCAAACCCAGTGG - Intronic
1032533238 7:132638987-132639009 CCAGCACTTCCCAGTTCCAGTGG + Intronic
1034500347 7:151446744-151446766 CCAGCCACTGTCAGTACCAGTGG + Intergenic
1036286308 8:7446837-7446859 CCAACCACTCCCCGTCCCATTGG - Intronic
1036335168 8:7864691-7864713 CCAACCACTCCCCGTCCCATTGG + Intronic
1037794259 8:21978673-21978695 CCCACTACTGCCAGCCCCAGGGG - Intronic
1037987094 8:23296764-23296786 CCAGCAATTCCCAGTGGCAGTGG - Intergenic
1038476492 8:27872054-27872076 CCAGATCCTCCCAGTGCCTGTGG + Exonic
1040575166 8:48645697-48645719 CCTGCTCCTCCCAGTCCCAGTGG + Intergenic
1041444876 8:57939905-57939927 TCAGCTTTTCCCAGTGCCAGCGG + Intergenic
1043802960 8:84634483-84634505 CCAGCAACTCACAGTCCAATAGG - Intronic
1045063388 8:98426706-98426728 CCAGCTCCCGCCAGACCCAGCGG + Intronic
1046238863 8:111464201-111464223 CCAGGGACTCCCACTCCTAGGGG + Intergenic
1046544928 8:115638009-115638031 CCAGATTTTCCCAGTCCCACAGG + Intronic
1046770612 8:118112897-118112919 CAAGCTCCTGCCACTCCCAGTGG + Intergenic
1049315397 8:141964344-141964366 CCAGCTGTGCCCAGTCCCCGTGG + Intergenic
1050509993 9:6384443-6384465 CCAGCTACCCCCAGTGCCTTGGG + Intergenic
1054864679 9:69987875-69987897 ACGGCTGCTCCCAGTTCCAGGGG - Intergenic
1055962160 9:81830973-81830995 CCAGCTACTCACAAATCCAGAGG - Intergenic
1056168329 9:83959335-83959357 CCAGCTACTCCCAGAGGCTGAGG + Intergenic
1057305502 9:93909979-93910001 CCAGCTCCTCAAAGTCCCTGAGG + Intergenic
1057599497 9:96445062-96445084 CCATCAACTCTCAGTTCCAGTGG + Intergenic
1059399395 9:114059465-114059487 CCACCTACTCCCTTTCCCAAGGG + Intergenic
1060428696 9:123528355-123528377 CAAGCAACTCCCAGTCCTGGAGG - Intronic
1060509078 9:124219013-124219035 CCAGCCCCTCCCAGACACAGGGG + Intergenic
1060836156 9:126756467-126756489 CCTGCCCCTCCCAGTCCCTGTGG - Intergenic
1060941479 9:127545398-127545420 CCAGCTCCCGCCAGGCCCAGGGG + Intronic
1061804170 9:133128890-133128912 CCAGCTGCCCCCAGCCCCACGGG - Intronic
1061912367 9:133732000-133732022 CCAGCTTCTCCCTGTCCCAGTGG - Intronic
1062586418 9:137251866-137251888 CCACCTACACCCAGACCCTGAGG + Exonic
1062690087 9:137837161-137837183 CCAGCTACGGGCTGTCCCAGGGG - Intronic
1186728259 X:12380609-12380631 GCAGCAACTTGCAGTCCCAGTGG - Intronic
1187250833 X:17596710-17596732 CCAGCCACTCCAAGTCTCAGGGG + Intronic
1188094302 X:26003050-26003072 CCAGGGACTCCCACTCCTAGGGG + Intergenic
1189178598 X:38982347-38982369 CCAGCTCCTCCCAATCCCATAGG - Intergenic
1192167402 X:68834557-68834579 CCAGCTCCACCCAGCCCCCGAGG - Intronic
1192583512 X:72303339-72303361 TCACATTCTCCCAGTCCCAGTGG - Intronic
1193047672 X:77069552-77069574 CCAACTTCTCCCTGTCCCATAGG - Intergenic
1194994249 X:100575456-100575478 CCAGCTGGTCCCTGTCCCATGGG + Intergenic
1195643433 X:107202886-107202908 CCAGCTACTTGTAGCCCCAGAGG + Intronic
1197007183 X:121515420-121515442 GCAGCTACACCCAGGCCCAAGGG + Intergenic
1200062224 X:153488735-153488757 CCACCTTCTCGCAGTCCCAGAGG + Intronic
1200142566 X:153909345-153909367 CCAACTCCTCCCACTCCCACTGG + Intronic
1201280657 Y:12339401-12339423 CCTGCCACTCCCAGTGCCTGGGG + Intergenic