ID: 915153708

View in Genome Browser
Species Human (GRCh38)
Location 1:153856885-153856907
Sequence CCATATCCATAGTATCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915153708_915153714 -2 Left 915153708 1:153856885-153856907 CCCTCCAGATACTATGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 915153714 1:153856906-153856928 GGTTACTTGTTGGCTTGTAAGGG 0: 1
1: 0
2: 0
3: 5
4: 83
915153708_915153716 29 Left 915153708 1:153856885-153856907 CCCTCCAGATACTATGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 915153716 1:153856937-153856959 CCTTTTTGCATGCAGATGATAGG 0: 1
1: 0
2: 0
3: 10
4: 157
915153708_915153713 -3 Left 915153708 1:153856885-153856907 CCCTCCAGATACTATGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 915153713 1:153856905-153856927 TGGTTACTTGTTGGCTTGTAAGG 0: 1
1: 0
2: 0
3: 14
4: 110
915153708_915153717 30 Left 915153708 1:153856885-153856907 CCCTCCAGATACTATGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 915153717 1:153856938-153856960 CTTTTTGCATGCAGATGATAGGG 0: 1
1: 0
2: 0
3: 16
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915153708 Original CRISPR CCATATCCATAGTATCTGGA GGG (reversed) Intronic
904937007 1:34138193-34138215 GCTTAACCATAGTATGTGGAGGG - Intronic
908910311 1:69065340-69065362 CCATGTCCTTAGAGTCTGGAGGG + Intergenic
909597102 1:77418445-77418467 CCATATCACTAGTCTGTGGAAGG + Intronic
913473088 1:119209877-119209899 CCATTTCTATTGAATCTGGAGGG - Intergenic
915153708 1:153856885-153856907 CCATATCCATAGTATCTGGAGGG - Intronic
916947853 1:169746995-169747017 CCAAACCCATAGTATCTCCAAGG - Intronic
920008797 1:202852894-202852916 CAATATCCATTGTATTTGTAGGG + Intergenic
920051396 1:203167013-203167035 CAATACCCCTAGTATCTGGCTGG + Exonic
921829471 1:219711054-219711076 CCAACTCCATAGTATGTGGGTGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1067724546 10:48760034-48760056 CAATCTCCAACGTATCTGGAGGG + Intronic
1070740978 10:78903084-78903106 CCATGTCCAGACTATCCGGATGG + Intergenic
1072877439 10:99188031-99188053 TCATATCCATGGTTTCTGCAAGG + Intronic
1074174652 10:110985749-110985771 TCATACCTATAGTATCTGGGAGG - Exonic
1076497487 10:130906391-130906413 CCATGTCCATAGTTGATGGAAGG - Intergenic
1077617854 11:3691434-3691456 CCACTTCCTTCGTATCTGGAGGG - Exonic
1079742956 11:24086530-24086552 CAATACTCACAGTATCTGGAGGG - Intergenic
1081196108 11:40162720-40162742 CCATTTCCTTAGCATCTGGGAGG - Intronic
1081198516 11:40190244-40190266 CTATATCTAAAGTATTTGGATGG - Intronic
1088347108 11:108839078-108839100 ACATACCCATAGTATAGGGAAGG + Intronic
1095600472 12:44007603-44007625 CCATATCAATACTATTTAGAGGG - Intronic
1098938197 12:76504468-76504490 GCATTTCCACAGTATTTGGAAGG + Intronic
1101023640 12:100578833-100578855 CCATACCCATAATATATGTATGG + Intronic
1106667490 13:31867505-31867527 CCATATCCATATGATTTGGGGGG + Intergenic
1115799642 14:36978229-36978251 CCAAACCCATAGTATCTCCAAGG - Intronic
1117608161 14:57453475-57453497 ACAAAACCAGAGTATCTGGAGGG - Intergenic
1127603094 15:60558169-60558191 ACATCTCCATGGTCTCTGGATGG + Intronic
1130001537 15:80051828-80051850 TCATCTTCACAGTATCTGGATGG - Intergenic
1140073791 16:71677339-71677361 CCATGTCCAGAGTATAAGGATGG + Intronic
1141232501 16:82182366-82182388 CCTTGTCCATAGTATCTGATTGG + Intergenic
1144435648 17:15237914-15237936 CTAAATCCATATTATCTTGAGGG + Intronic
1145740625 17:27271307-27271329 CCCTAGGCATAGTAACTGGAGGG + Intergenic
1147498527 17:40940092-40940114 ACATACACATAGTATCTGAAAGG - Intergenic
1148405842 17:47414840-47414862 CCACCTCCATATTATCTGGAAGG - Exonic
1148406023 17:47416829-47416851 CCAACTCCATATTATCTAGAAGG - Intronic
1149669199 17:58390989-58391011 ACATATCTACAGTATCTGAAGGG + Intronic
1150345223 17:64399339-64399361 CCATGTCCCTTGTAACTGGAGGG - Intronic
1156681902 18:39600480-39600502 CCAGATCTATAGTATCTGTCTGG + Intergenic
1162842875 19:13369161-13369183 CAACATCCATAGCAGCTGGAGGG - Intronic
929167649 2:38899871-38899893 TCATATCCATTGTACCTGGCAGG - Intronic
929401468 2:41586869-41586891 CCATAACCATGAGATCTGGAAGG + Intergenic
930617180 2:53605845-53605867 TCACATCCATATTCTCTGGAAGG - Intronic
931450900 2:62366793-62366815 CCTTCTCCATAGAATATGGAAGG + Intergenic
932088998 2:68788176-68788198 CCATCTCCAAATTAACTGGAGGG + Intronic
933321198 2:80777572-80777594 ACATATCCCTAGTGTTTGGAAGG - Intergenic
935869940 2:107436841-107436863 CCAAATCCCTAGAATCTGGCTGG + Intergenic
936459782 2:112704908-112704930 GCATATCCACAGTATCTACAGGG - Intergenic
939182681 2:138822554-138822576 CCATATCCATCCTATCTGGTGGG + Intergenic
940800606 2:158128712-158128734 ACATGTTCATAGTCTCTGGACGG + Intronic
943101615 2:183493455-183493477 CCATTTCCAGAGTCTCTGAATGG + Intergenic
946671338 2:222107990-222108012 CCATATCCATTGTATTTGTTGGG - Intergenic
946933294 2:224693342-224693364 CCATATCCATTGTATCCTTAAGG - Intergenic
947654422 2:231813999-231814021 CCAAATCCACAGTATCTCCAAGG - Intergenic
1171125845 20:22601346-22601368 GCATATCCCAAGTACCTGGAAGG + Intergenic
1173195096 20:40907759-40907781 CCATCCCCACAGTATCCGGAAGG + Intergenic
950274605 3:11648243-11648265 CTATATCCACAGTATCTGTCTGG - Intronic
951741236 3:25926456-25926478 CCAAATCCATAATATCTCCAAGG - Intergenic
953968882 3:47331925-47331947 CCATATCCACAGTAGCAGGAGGG + Intronic
960073374 3:113457229-113457251 CCAGATTCATGTTATCTGGAGGG + Exonic
963260113 3:143183993-143184015 CCATATTCATAGAATGTGGTTGG - Intergenic
963540334 3:146579607-146579629 CCGAAGCCATAATATCTGGAAGG - Intronic
965217165 3:165878085-165878107 CCATATCCCTTGTCTCTGAACGG - Intergenic
967726829 3:192869963-192869985 GCATATCAATAGTACTTGGATGG + Intronic
977203212 4:94140716-94140738 GAATATCCAGAGCATCTGGATGG + Intergenic
980731141 4:136825407-136825429 CCATATCCAGATTGCCTGGAGGG + Intergenic
982748604 4:159132348-159132370 TCACAACCATAGGATCTGGATGG - Intronic
986494196 5:8326032-8326054 CCATATGAACAGTATCTGTATGG + Intergenic
993288797 5:86038253-86038275 ACAAATCCAAAGTCTCTGGAAGG + Intergenic
997201839 5:132014671-132014693 CCATATCCACACCCTCTGGAGGG - Intergenic
998036990 5:138925894-138925916 CCATAGCCAGAGTGCCTGGAGGG + Intronic
998037551 5:138929683-138929705 TCATACCCATAGTATCGAGATGG - Intronic
1000150494 5:158496077-158496099 CCATATCCATACAATCAAGAGGG - Intergenic
1002814698 6:668940-668962 CCATATCCATGGGTTCTGCATGG - Intronic
1009963182 6:70549476-70549498 CCACATCCACAGTATCTCCAAGG - Intronic
1017853567 6:158328401-158328423 CCAAATACATAGAATCTAGAAGG - Intronic
1021958986 7:25853544-25853566 CCAGATCCTTAGTGTCTGCAGGG - Intergenic
1023673797 7:42608236-42608258 TCAATTCCATAGTATTTGGATGG + Intergenic
1028021253 7:85776843-85776865 CCATCTGCATATTATTTGGAAGG - Intergenic
1034738433 7:153451168-153451190 CCACATCCATTGTATCTGTGTGG - Intergenic
1050652860 9:7791776-7791798 CCATAGCCATAGCATAGGGAAGG - Intergenic
1055574898 9:77650958-77650980 CCTTATCTGTAGAATCTGGAAGG + Intergenic
1062372873 9:136249208-136249230 CCATGTCCACAGTCCCTGGAGGG - Intergenic
1191987895 X:67001664-67001686 CCATATCCACAGGATCTGGGTGG - Intergenic
1199539338 X:148941640-148941662 CAAAATGCAAAGTATCTGGATGG - Intronic
1200354204 X:155531053-155531075 ACACATCCCTAGTATTTGGAAGG + Intronic