ID: 915161190

View in Genome Browser
Species Human (GRCh38)
Location 1:153922254-153922276
Sequence GCACCCTGAGGGCACCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 210}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915161175_915161190 19 Left 915161175 1:153922212-153922234 CCATCCGCCCGCAAACACAAGAC 0: 1
1: 0
2: 0
3: 0
4: 71
Right 915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 210
915161177_915161190 12 Left 915161177 1:153922219-153922241 CCCGCAAACACAAGACTGAGCAG 0: 1
1: 0
2: 1
3: 15
4: 186
Right 915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 210
915161171_915161190 30 Left 915161171 1:153922201-153922223 CCCCATTCGTCCCATCCGCCCGC 0: 1
1: 0
2: 1
3: 6
4: 71
Right 915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 210
915161172_915161190 29 Left 915161172 1:153922202-153922224 CCCATTCGTCCCATCCGCCCGCA 0: 1
1: 0
2: 0
3: 6
4: 44
Right 915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 210
915161176_915161190 15 Left 915161176 1:153922216-153922238 CCGCCCGCAAACACAAGACTGAG 0: 1
1: 0
2: 0
3: 9
4: 97
Right 915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 210
915161174_915161190 20 Left 915161174 1:153922211-153922233 CCCATCCGCCCGCAAACACAAGA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 210
915161178_915161190 11 Left 915161178 1:153922220-153922242 CCGCAAACACAAGACTGAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 218
Right 915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 210
915161173_915161190 28 Left 915161173 1:153922203-153922225 CCATTCGTCCCATCCGCCCGCAA 0: 1
1: 0
2: 0
3: 3
4: 38
Right 915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG 0: 1
1: 0
2: 2
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915161190 Original CRISPR GCACCCTGAGGGCACCACTG GGG Intronic
900276481 1:1832699-1832721 GGGTCCTGAGGGCACCGCTGAGG - Intronic
900354536 1:2253916-2253938 GCACTCTGGGGACACCACTCTGG - Intronic
900383156 1:2395389-2395411 GAACCCTGAGGGATCCACAGAGG + Intronic
900392445 1:2439630-2439652 GCAGCCTGAGGTCACCATGGAGG - Intronic
900626321 1:3610340-3610362 ACAGCCTGAGGGCCCCTCTGTGG + Intronic
901772011 1:11535346-11535368 GCACACCGAGGGGACCCCTGAGG - Intronic
902359086 1:15932267-15932289 ACGTCCTGAGGCCACCACTGAGG + Exonic
905178110 1:36150633-36150655 GCACCCTGAGGGAGGGACTGGGG - Intronic
905220012 1:36439043-36439065 GCTCCCTGAGGGGACCACACAGG + Intronic
905371599 1:37485411-37485433 GCAGCCTCAAGGCTCCACTGTGG - Intergenic
907653352 1:56317902-56317924 GCAGGCTCAGGGCACCCCTGTGG - Intergenic
915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG + Intronic
916634722 1:166656295-166656317 GGACCCTGAGGGCTCCAGCGAGG - Intergenic
917539034 1:175895754-175895776 GCTCCCTGAGGGCAGGACTGGGG - Intergenic
919886751 1:201940528-201940550 GCACCCAGAGGGCAGCACTGAGG + Intronic
921263401 1:213403348-213403370 ACAGCCTGAGGGCACCCCTCGGG - Intergenic
1062800165 10:372943-372965 GCACACGGAGGGTACCCCTGGGG - Intronic
1066015161 10:31233636-31233658 GCACACTGCCGCCACCACTGAGG + Intergenic
1066653489 10:37680366-37680388 GCGGCCTGAGGGCACTGCTGAGG + Intergenic
1067059502 10:43070702-43070724 GCAGCCTGCAGACACCACTGGGG + Intergenic
1067066967 10:43109655-43109677 TCCCCCTGAGGGCACCACTGTGG - Intronic
1070565810 10:77603175-77603197 GAGCCCTGAGGGCACCAGGGGGG - Intronic
1070608913 10:77919886-77919908 CCACCATGAGGTCACCACTTAGG + Intronic
1071855879 10:89623850-89623872 CCACCCTGAGGGAACCCTTGTGG - Intronic
1072439470 10:95441038-95441060 GCACCCTGAAGGCCCCACTCTGG - Intronic
1072713679 10:97735291-97735313 CCACACTGAGGGTACCACTATGG + Intergenic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1075063548 10:119273562-119273584 GCACCCTCAGGCCACAAGTGTGG + Intronic
1076628926 10:131841240-131841262 ACACCCGGAGGGCACCAACGAGG - Intergenic
1076672855 10:132132750-132132772 GCAACGTAGGGGCACCACTGTGG - Intronic
1077235487 11:1480174-1480196 GCACCTTCTGGGCCCCACTGGGG + Intronic
1077325805 11:1963534-1963556 TTCCCCTGAGGGCACCCCTGAGG + Intronic
1077458034 11:2692634-2692656 GCACCCTGAGGGGAGTGCTGAGG - Intronic
1078096342 11:8299541-8299563 GCAACTTGAGGGCAGAACTGTGG - Intergenic
1079131428 11:17749020-17749042 GAACCCTGTGAGCACCACGGAGG - Intronic
1084796017 11:71504548-71504570 GCAGCCTGAGGGCAGCACAGGGG + Intronic
1085750195 11:79154855-79154877 GCCCCCTGAGGACACCCCGGTGG - Intronic
1085771711 11:79331457-79331479 GCACCCTGTGAGCACCACCCAGG - Intronic
1086282613 11:85208619-85208641 GCTCCCTGTTGGGACCACTGGGG - Intronic
1088826664 11:113501002-113501024 GCACCTGGAGGGCACATCTGAGG + Intergenic
1089630040 11:119778812-119778834 GGAGGCTGAGGGCTCCACTGGGG + Intergenic
1090178472 11:124673214-124673236 CCTCCCCAAGGGCACCACTGAGG + Intronic
1090606192 11:128425031-128425053 GTACCCAGAGAGCTCCACTGAGG - Intergenic
1090995508 11:131862226-131862248 TCACTCTGAGGGCACAACTGGGG + Intronic
1202808785 11_KI270721v1_random:18713-18735 TTCCCCTGAGGGCACCCCTGAGG + Intergenic
1091676928 12:2498329-2498351 GCACCCTGGGGGTAGCACGGAGG - Intronic
1091870717 12:3888705-3888727 GCACCCTGAGCGTCACACTGAGG - Intergenic
1092291561 12:7162488-7162510 TCACCCTGGGGGCTTCACTGGGG + Intergenic
1093746009 12:22741818-22741840 CCACCCTCAGGGCAACCCTGAGG - Intergenic
1094526806 12:31236503-31236525 GCAACCTGAGGGCAGCAAAGAGG + Intergenic
1096525405 12:52207308-52207330 GCACCCTGAGGGCAGAACTCTGG + Intergenic
1096573897 12:52540753-52540775 GCACCCTCAGGACACCTCTGGGG - Intergenic
1096792109 12:54051808-54051830 GCACCCTTTGGGCACGGCTGTGG + Intronic
1097021637 12:56025093-56025115 GCTCACCGAGGGCCCCACTGGGG - Exonic
1100091575 12:90978230-90978252 GTTCCCTGAAGGCATCACTGTGG + Exonic
1103972811 12:124682579-124682601 GTACCCTGAGCCCAGCACTGGGG + Intergenic
1108384905 13:49890462-49890484 GCAACCGGAGCGGACCACTGAGG - Intergenic
1108590703 13:51910729-51910751 GCAACCGGAGCGGACCACTGCGG + Intergenic
1109126830 13:58528486-58528508 GCAACCAGAGCGGACCACTGAGG - Intergenic
1109155602 13:58905961-58905983 GCCCACTGAGTCCACCACTGGGG - Intergenic
1111468428 13:88646425-88646447 GCTCACTGGAGGCACCACTGGGG - Intergenic
1113843044 13:113371263-113371285 GCACTGTGCGGGCTCCACTGGGG - Intergenic
1114666719 14:24381854-24381876 GAACCCTGAGGGCACTAGTTAGG + Intergenic
1115475828 14:33811976-33811998 GCACCATGAGAGCTCCTCTGGGG + Intergenic
1116003373 14:39267330-39267352 GCAACCGGAGTGGACCACTGCGG - Exonic
1117007824 14:51440157-51440179 AGATCCTGAGGCCACCACTGTGG + Intergenic
1121108558 14:91296523-91296545 GGACCCTGAGGGCCCCACGGGGG - Intronic
1121781293 14:96624097-96624119 GCACCTCGAGGGCACCCCAGTGG + Intergenic
1122132437 14:99612709-99612731 CCTCCAGGAGGGCACCACTGGGG - Intergenic
1122278301 14:100606519-100606541 ACGCCCTGAGGACACCACAGAGG - Intergenic
1122313746 14:100813506-100813528 GCACCCTGTGGCCCTCACTGTGG + Intergenic
1122928845 14:104924044-104924066 GCACCCTGAGGCCATCACCCTGG + Intergenic
1122929199 14:104925747-104925769 GCACCCTGAGGTCTCCTCTGTGG + Intronic
1123030209 14:105447987-105448009 CCACCCTGAGGCCTGCACTGTGG - Intronic
1128659543 15:69488169-69488191 GCTCCCTGAAGGCAACAGTGAGG - Intergenic
1129150740 15:73686161-73686183 GGACCCTGACTGCATCACTGAGG - Intronic
1132468658 16:89687-89709 GGACCCCCAGGGCACCGCTGTGG - Intronic
1132517269 16:371570-371592 GAGCCCTGAGCCCACCACTGGGG - Exonic
1132600169 16:769611-769633 GCAGCCTGTGGGCCCCCCTGGGG - Exonic
1137666624 16:50253574-50253596 CCAGCCTGAGGGCACCACAAAGG - Intronic
1141266062 16:82498378-82498400 GCTCCCTGTGGGGTCCACTGAGG + Intergenic
1141653391 16:85405134-85405156 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141653453 16:85405397-85405419 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141653483 16:85405529-85405551 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141653513 16:85405662-85405684 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141653692 16:85406388-85406410 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141653722 16:85406520-85406542 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141653837 16:85406982-85407004 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141654191 16:85408369-85408391 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141654279 16:85408762-85408784 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141654402 16:85409255-85409277 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141654529 16:85409752-85409774 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141654623 16:85410114-85410136 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141654727 16:85410541-85410563 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141654763 16:85410702-85410724 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141654800 16:85410863-85410885 GGACCCTGAGTGCAACAGTGAGG - Intergenic
1141717434 16:85734932-85734954 GCACCCTGAGGGGGAAACTGAGG + Intronic
1142060266 16:88024664-88024686 GCACTCTGCGGGCAGCACTTGGG + Intronic
1142107042 16:88309750-88309772 GCACCGAGAGGGCACCTCAGAGG - Intergenic
1143871343 17:9959169-9959191 CCACCCTGAGGGCGCCCCTCGGG + Intronic
1144019135 17:11224392-11224414 GCACCTTAAGGGAAGCACTGGGG - Intergenic
1144669416 17:17124570-17124592 CCATCCTGAAGGAACCACTGTGG - Intronic
1144795407 17:17888057-17888079 GAAGCCTGAGAGCAGCACTGAGG + Intronic
1144945094 17:18965723-18965745 GCACCATGTAGCCACCACTGGGG - Intronic
1145971652 17:28959803-28959825 CTACCCTGTGGGTACCACTGTGG - Exonic
1151599760 17:75099002-75099024 GCAGCCTGAGGGCCCGCCTGAGG + Intronic
1152739777 17:82013785-82013807 GCAGTGTGGGGGCACCACTGTGG + Intronic
1152848924 17:82619917-82619939 TAACCCGGAGGGCACCGCTGCGG + Intronic
1152865849 17:82722492-82722514 GCAGCCTGCGGGCACCTCTCAGG - Intronic
1152903167 17:82956818-82956840 GCACCCTGAGGGCGTCTCTCCGG - Intronic
1155081794 18:22417996-22418018 GCAACCGGAGCGTACCACTGCGG + Intergenic
1157727685 18:49977543-49977565 GCACTGTGAGGGCACCAATGGGG + Intronic
1160011716 18:75111183-75111205 ACACCCTCAGGGGACCCCTGGGG - Intergenic
1160911251 19:1474801-1474823 GTGACCTGAGGGCCCCACTGGGG - Exonic
1161222495 19:3124112-3124134 GCACCCAGGCGGCCCCACTGAGG - Intergenic
1162565753 19:11445254-11445276 GGACCCTGAGGACACGACTGTGG - Intronic
1163688667 19:18726366-18726388 GCCGCCTGAGGGCTCCTCTGGGG - Intronic
1164720494 19:30428527-30428549 CCACCCTGTGGGGACCACAGTGG + Intronic
1166071126 19:40388693-40388715 GCACCCTGAGGGCAAGGCTGGGG - Intronic
1166217248 19:41343714-41343736 GCCCCATGAGGGCAGAACTGAGG + Intronic
1166872084 19:45877029-45877051 GCCACCTGAGGTCCCCACTGGGG - Intergenic
1167053876 19:47096556-47096578 GCACCCTGATGGGAATACTGGGG + Intronic
924983413 2:244999-245021 ACAGCCTGAGGGAACCACTCTGG + Intronic
925512062 2:4638711-4638733 TCATCCTGAGGGCAGCCCTGTGG + Intergenic
938094575 2:128453061-128453083 GGAACCTGAGGGGACCACTGGGG - Intergenic
938578862 2:132628227-132628249 GGAGCCTCAGGGCACCAGTGGGG - Intronic
938910959 2:135885706-135885728 GCTCCCTGTGGGCTCCACCGAGG - Intergenic
946104638 2:217358536-217358558 GGACCCAGAGGACAGCACTGAGG - Intronic
947436686 2:230078865-230078887 GTATCCTGAAGGCCCCACTGTGG - Intergenic
947612773 2:231533890-231533912 GCTCCTAGAGGGGACCACTGGGG + Intergenic
947636430 2:231682857-231682879 GGACGCTGAGGGCAGCGCTGGGG - Intergenic
947736737 2:232459138-232459160 GCTCCCTGAGTGCCCCACTCCGG + Exonic
947840790 2:233206700-233206722 GCTCACTGAGGGCTTCACTGTGG - Exonic
948921559 2:241068316-241068338 GCTCTCTGAGGGGTCCACTGTGG - Intronic
949072490 2:242033995-242034017 CCACCTTGGGGGCACCACAGAGG + Intergenic
1171035885 20:21712854-21712876 GCACTCTGAGACCACCGCTGAGG - Intronic
1172231698 20:33341007-33341029 GCATCCTGAGGGATACACTGTGG - Intergenic
1174461849 20:50688879-50688901 GGACCCTGGGGGGAGCACTGAGG + Intronic
1175251943 20:57615215-57615237 CCACCCTCAGGGCACCTCTGCGG - Intronic
1175921476 20:62452395-62452417 ACAGCCTGAGGGCACGACTAAGG - Intergenic
1175961813 20:62641283-62641305 GAGCCCTGAGGACACCACCGGGG + Exonic
1175994975 20:62807984-62808006 GCACCCTGAAGGCAGCACAGGGG - Intronic
1176385989 21:6138750-6138772 GCACCCTCAGGGCAGCACCCCGG + Intergenic
1176426380 21:6551057-6551079 GCACTCTGAGGGCAGCTCGGGGG + Intergenic
1179367025 21:40768241-40768263 GCACCCAGATGGCACCCCAGTGG + Intronic
1179613782 21:42568948-42568970 GCAGCCTGACGGCACGGCTGTGG + Intronic
1179701871 21:43159374-43159396 GCACTCTGAGGGCAGCTCGGGGG + Exonic
1179737484 21:43399502-43399524 GCACCCTCAGGGCAGCACCCCGG - Intergenic
1179967807 21:44817282-44817304 GCACACTGAGGGCACGATTGGGG + Intronic
1181034915 22:20165270-20165292 GCAGCCTAAGACCACCACTGTGG - Intergenic
1181508905 22:23380089-23380111 GCAGCCTAAGACCACCACTGTGG + Intergenic
1183933760 22:41250241-41250263 GCTCCCTGAGGGCCCGCCTGTGG - Intronic
1184098253 22:42328313-42328335 GCATCCTGTGGGCTCCCCTGAGG + Intronic
1184188881 22:42881797-42881819 CCACCGTGAGGGGAGCACTGTGG + Intronic
1184482555 22:44756344-44756366 GCTCCCTGAAGGTACCTCTGAGG + Intronic
1184751107 22:46487457-46487479 ACACCTTGAGGGCAGGACTGTGG - Intronic
1185156535 22:49196475-49196497 GGACCCTGATGGCTCCACAGAGG + Intergenic
1185372997 22:50469492-50469514 ACACCCTGAGTGTCCCACTGTGG - Intronic
950131471 3:10549867-10549889 GCCCACTGAGGGGCCCACTGAGG + Intronic
950160424 3:10756652-10756674 GCTCCCTGAGGGAGCCCCTGAGG + Intergenic
953820689 3:46205205-46205227 GGACACTGAGGGCACCAGAGTGG + Intronic
954594894 3:51815869-51815891 ACACACTGAGGGTACCTCTGAGG - Intergenic
960452605 3:117828971-117828993 GCACCCAGAGGGCAAAAGTGGGG + Intergenic
960938560 3:122918719-122918741 GCAGCCTGAGGGGACCCCTGAGG + Intronic
966715569 3:183010328-183010350 GCACCCTGGGGTCAGCCCTGAGG + Intergenic
968442302 4:630088-630110 GAACCCAGAGGGCACCAGAGAGG + Intronic
969149615 4:5158267-5158289 TTACCCTGAGGGCACCAAGGGGG + Intronic
973316686 4:48767916-48767938 GATCTCTGAGGGCACCGCTGGGG - Intronic
973727575 4:53791286-53791308 GCACCTAGAAGGCTCCACTGTGG + Intronic
983660696 4:170128034-170128056 GCACCATGAGGGCCCCTCTCTGG - Intergenic
985549948 5:528087-528109 GCTCCCTGAGGGCACCAGCCCGG + Intergenic
986778711 5:11044890-11044912 GCCCCCTTGGGCCACCACTGGGG + Intronic
989001127 5:36762024-36762046 GAACCCAGCGGGCAGCACTGGGG - Intergenic
998943928 5:147316799-147316821 GAACTATGATGGCACCACTGTGG + Intronic
999696330 5:154190968-154190990 GCAGCCCGACGGCACCCCTGGGG + Exonic
1001192228 5:169641781-169641803 GCATGCTGGGGCCACCACTGTGG - Intronic
1001278215 5:170366368-170366390 GCCCCCTGAGGACACCACCCTGG + Intronic
1001632074 5:173182887-173182909 GAGCCATGATGGCACCACTGTGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002360268 5:178664780-178664802 GGACCCTGAAGTCAGCACTGGGG - Intergenic
1003221735 6:4166445-4166467 GCTGCCTGAGGGAAGCACTGGGG + Intergenic
1005813120 6:29531111-29531133 GCACCCTGAGGCCTCCATGGGGG + Intergenic
1006014565 6:31069716-31069738 GCACACTGACGTCAACACTGAGG + Intergenic
1007177204 6:39905116-39905138 GCAGGCAGGGGGCACCACTGAGG + Exonic
1007218815 6:40262445-40262467 GCATCCAGAGGGGACTACTGTGG - Intergenic
1007704851 6:43784343-43784365 GCTCCCTGAGGGCAGGGCTGGGG + Intronic
1011283878 6:85704117-85704139 GCACCCTGAGGCCTCCCCAGGGG + Intergenic
1015881929 6:137878789-137878811 GAACCCTGAGGAGTCCACTGGGG + Exonic
1016745221 6:147572215-147572237 GGAACCTGAAGGAACCACTGTGG + Intronic
1017131116 6:151108969-151108991 GCAGCCTGAGGCCAGCCCTGGGG + Intergenic
1018214639 6:161514857-161514879 GCACCATGACGGCAGCACTAAGG - Intronic
1018675784 6:166221252-166221274 TTACCCTGAGGGCACCTGTGGGG - Intergenic
1018987309 6:168647555-168647577 GCTCCCTGTGGGCAACAGTGGGG + Intronic
1023090868 7:36616142-36616164 GAACCCTGAAGGCAGCAGTGGGG - Intronic
1023730689 7:43188995-43189017 TCACCCTGTGGGCATCACTCAGG - Intronic
1025973652 7:66352339-66352361 GCAGCCAGTGGGCAGCACTGAGG - Intronic
1028194996 7:87895824-87895846 CCACCCTCAGGGCAGAACTGTGG + Intronic
1028426099 7:90691186-90691208 GGACCATGAGGGTACAACTGTGG + Intronic
1029316577 7:99720943-99720965 GCACCCTGCAGACAGCACTGTGG + Intronic
1030375016 7:108744876-108744898 GCAGACTGAGGGCAGCAGTGGGG + Intergenic
1032255967 7:130297416-130297438 GCACCCTGTGGGCACTGCCGAGG - Intronic
1033028198 7:137798226-137798248 AGACCCAGAGGGCTCCACTGGGG + Intronic
1034748321 7:153544145-153544167 TCACCCTCATGGCACCCCTGAGG - Intergenic
1035365795 7:158348887-158348909 GGTCCCTGAGGGCACTGCTGAGG + Intronic
1035365929 7:158349338-158349360 GGTCCCTGAGGGCACTGCTGAGG + Intronic
1035574762 8:697448-697470 GCACCCTGGCAGCACCCCTGAGG - Intronic
1036296185 8:7540063-7540085 GCATCCTGTGGCCTCCACTGTGG - Intronic
1036326381 8:7780956-7780978 GCATCCTGTGGCCTCCACTGTGG + Intronic
1036451259 8:8869982-8870004 GCACACTCAGGGCAGCAGTGTGG - Intronic
1037578489 8:20230463-20230485 CCACCCTCAGGGCAGCTCTGTGG - Intergenic
1038055183 8:23851351-23851373 GAACCCTGAAGCCATCACTGAGG - Exonic
1039742930 8:40398545-40398567 GCACCCAGAGGGCCTCCCTGAGG + Intergenic
1039789766 8:40865966-40865988 GCACACAGAGGGCACTCCTGGGG - Intronic
1040306454 8:46214417-46214439 GCACCACTAGGACACCACTGAGG - Intergenic
1040547087 8:48407177-48407199 GGACCCTGAGGGCTCCTCTCAGG + Intergenic
1046915199 8:119672212-119672234 GCAGCCAGAGGTGACCACTGCGG + Intronic
1046940595 8:119927215-119927237 GGTCTCTGAAGGCACCACTGTGG + Intronic
1049698331 8:143994462-143994484 TCATCCTGAGGGCACCACCGAGG - Intronic
1049714292 8:144082661-144082683 GCAGCCTGTGGGCACCGCGGCGG + Exonic
1051053865 9:12960116-12960138 GCTCCCTGAGGGGACCAATAAGG - Intergenic
1059236987 9:112769467-112769489 TCATCCTGAGGGCACAACTAAGG + Intronic
1059467550 9:114478609-114478631 GCTGCCTCAGGGCACCACCGTGG + Exonic
1061578807 9:131524217-131524239 GCACCTTGGGGGCTCCCCTGAGG + Exonic
1062365442 9:136206000-136206022 CCAGCCTGAGGGCACCTCAGAGG - Intergenic
1062572279 9:137191225-137191247 GCAGCATGAGGGCAGCACAGGGG - Intergenic
1203665882 Un_KI270754v1:20459-20481 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203667031 Un_KI270754v1:26098-26120 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203668179 Un_KI270754v1:31737-31759 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1187243311 X:17532507-17532529 GCACAGTGAGGGGAGCACTGAGG - Intronic
1190871730 X:54430414-54430436 GCAACCTGAGTGGACCACTTAGG + Intergenic
1199676212 X:150191275-150191297 GCACCCTGTGGGCAGCTCAGGGG - Intergenic