ID: 915162665

View in Genome Browser
Species Human (GRCh38)
Location 1:153931048-153931070
Sequence AGCCAAGGAGATGGGGCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 1, 1: 0, 2: 0, 3: 60, 4: 688}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915162650_915162665 18 Left 915162650 1:153931007-153931029 CCCACAGCAGCCGTACCTGAACA 0: 1
1: 0
2: 0
3: 10
4: 84
Right 915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG 0: 1
1: 0
2: 0
3: 60
4: 688
915162656_915162665 3 Left 915162656 1:153931022-153931044 CCTGAACAGAGGCTGGATCAGGG 0: 1
1: 0
2: 0
3: 19
4: 252
Right 915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG 0: 1
1: 0
2: 0
3: 60
4: 688
915162651_915162665 17 Left 915162651 1:153931008-153931030 CCACAGCAGCCGTACCTGAACAG 0: 1
1: 0
2: 1
3: 13
4: 115
Right 915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG 0: 1
1: 0
2: 0
3: 60
4: 688
915162654_915162665 8 Left 915162654 1:153931017-153931039 CCGTACCTGAACAGAGGCTGGAT 0: 1
1: 0
2: 0
3: 11
4: 115
Right 915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG 0: 1
1: 0
2: 0
3: 60
4: 688

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915162665 Original CRISPR AGCCAAGGAGATGGGGCCTG GGG Exonic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900241951 1:1621405-1621427 AGACAAGGAGAGGGGTCCCGTGG - Intronic
900293838 1:1938747-1938769 AGCCAGGCAGATGGGGTCAGGGG + Intronic
900413410 1:2523984-2524006 GGCAGAGGGGATGGGGCCTGTGG - Intronic
900422185 1:2560453-2560475 AGTCTTGGAGGTGGGGCCTGGGG - Intronic
900465133 1:2821763-2821785 CGGCCAGGACATGGGGCCTGGGG + Intergenic
900701685 1:4052514-4052536 AGCCAGGGAGGTGGAGGCTGTGG + Intergenic
900877433 1:5353318-5353340 AGCTACAGAGATGGGGGCTGAGG - Intergenic
900959338 1:5909302-5909324 AGACAAGGTGGTGAGGCCTGTGG - Intronic
900989157 1:6090147-6090169 AGTCAAGGACACGTGGCCTGTGG + Intronic
901020238 1:6251640-6251662 TGCCAAGGAGAAGGGGCCCTTGG + Intronic
901417504 1:9128082-9128104 ATACAAGGGGCTGGGGCCTGAGG + Intronic
902210226 1:14899679-14899701 AGCTAGGGAGGTGGGACCTGGGG - Intronic
902920362 1:19663040-19663062 ACCCAAGGAGATGGAGCCACTGG + Intergenic
903045077 1:20558467-20558489 AGCCGAAGAGATGAGGCCAGAGG + Intergenic
903166243 1:21522597-21522619 AGCCTAGGATCTGGGGCGTGAGG - Intronic
903663864 1:24995172-24995194 AGCCCAGCAGATGGGGGCAGAGG + Intergenic
903823186 1:26119328-26119350 AGCCAGGGAGATTGAGGCTGCGG + Intronic
903832522 1:26183570-26183592 AGCCCAGGTGATGGGGCCCATGG + Intronic
903853719 1:26323156-26323178 AGCCCAGGAGATTGAGGCTGCGG - Intronic
903861461 1:26367317-26367339 AGCCAAGGTCATGGGGGTTGGGG - Intronic
904038375 1:27570815-27570837 AGCCAAGAAGCTGGGGCAAGGGG - Intronic
904221374 1:28972675-28972697 AGCCCAGGAGTTGGAGGCTGCGG - Intronic
904563641 1:31414263-31414285 AGGAAAGGAGAGGGGGGCTGGGG - Intronic
904620096 1:31770054-31770076 AGCCCAGGAGAGAGGACCTGGGG - Intergenic
904653444 1:32024386-32024408 AGCCCAGGAGTTGGAGGCTGTGG - Intronic
905295410 1:36951495-36951517 TGCCGAGGAGAGGGGGCCTTGGG - Intronic
905714934 1:40141154-40141176 GGCCAAGGAGATGGCCCATGTGG - Intergenic
905771395 1:40640248-40640270 AGTCAGGGAGATGGGGACTTAGG - Intronic
906384143 1:45352974-45352996 AACCCAGGAGATGGTGGCTGTGG - Intronic
906626650 1:47331417-47331439 AGCCCAGGAGGTGGAGGCTGAGG - Intergenic
907300135 1:53481884-53481906 AGCCCAGGAGATGCTGTCTGTGG + Intergenic
907751642 1:57268988-57269010 AGCCAGGGAGATGGGGCCACTGG + Intronic
908195770 1:61744204-61744226 AGCCCAGGAGATGGAGGCTGTGG + Intronic
908444754 1:64190155-64190177 AGATAAGGCCATGGGGCCTGAGG + Intergenic
908844519 1:68311307-68311329 AGCCAATGAAATGGGTCATGTGG - Intergenic
911834726 1:102602667-102602689 AGCCAAGGAGAAGAGTCCAGTGG - Intergenic
912964166 1:114222880-114222902 AGGCAAGGAAAGGGGGCATGGGG - Intergenic
913346897 1:117818469-117818491 AGATAAGGCCATGGGGCCTGAGG - Intergenic
913978522 1:143487397-143487419 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
914072933 1:144313045-144313067 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
914106221 1:144653315-144653337 AGCCAAGGTCCAGGGGCCTGAGG - Intergenic
914457612 1:147850773-147850795 AGCCAAAGATATGGGCCCTCAGG + Intergenic
914677957 1:149918106-149918128 AGACAGGGAGATGGGGAATGTGG + Intergenic
914775813 1:150734104-150734126 AACCCAGGAGATGGAGGCTGCGG - Intronic
915029143 1:152861132-152861154 AGCCAAGGCCAAGAGGCCTGAGG - Intergenic
915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG + Exonic
915201453 1:154232773-154232795 AGCCCAGGAGATTGAGGCTGCGG - Intronic
915284183 1:154842390-154842412 GGCCGAGGAGAGGGGCCCTGGGG + Intronic
915309612 1:155000663-155000685 AGCCAAGGAAAGGGGGCGGGGGG - Intergenic
915326512 1:155083647-155083669 AGCCAAGGAAGTGGGGTCAGGGG + Intronic
915648218 1:157288966-157288988 CCCTAAGGAGGTGGGGCCTGAGG + Intergenic
916193218 1:162198893-162198915 ACCCAAGGACTTGGGGCTTGGGG + Intronic
916867391 1:168875079-168875101 ATTAAAGGAGATGTGGCCTGAGG + Intergenic
917095869 1:171398338-171398360 AGCCCAGGAGATCGAGGCTGCGG - Intergenic
917678237 1:177340457-177340479 ATCCCAGGAGATGGGGGCAGAGG + Intergenic
918002909 1:180514488-180514510 AGCCCAGGAGGTGGAGGCTGCGG + Intergenic
918983102 1:191588891-191588913 AGCCAAGAAGCAGGGGTCTGTGG + Intergenic
919303888 1:195805515-195805537 AGCCAGGGACATGGGTCCAGAGG + Intergenic
919356946 1:196536535-196536557 AGATAAGGCCATGGGGCCTGAGG - Intronic
919858944 1:201725562-201725584 AGCCCAGGAGTTGGGGCGGGGGG + Intronic
920251939 1:204627760-204627782 AGCCCAGGAGATGGGTGCAGGGG - Intronic
920422126 1:205842080-205842102 AGCCAAGGAGAGGGGCCTGGGGG + Intronic
921231772 1:213080640-213080662 AGCCCAGGAGATGGAGGCTGTGG - Intronic
921851706 1:219938817-219938839 ACCCATGGAGATTGAGCCTGTGG + Intronic
922427330 1:225510941-225510963 AGCCCAGGAGGTGGGGGTTGCGG + Intronic
922463924 1:225833715-225833737 AACCCAGGAGATGGAGCTTGTGG + Intronic
922798965 1:228355442-228355464 AGCCAGCAGGATGGGGCCTGTGG - Intronic
923397531 1:233581970-233581992 AGCCAAGAAACTGGGGCGTGGGG + Intergenic
924056295 1:240127553-240127575 AGCCCAGGAGATCGAGACTGCGG - Intronic
924437024 1:244050200-244050222 AGAAAAGGAACTGGGGCCTGAGG - Intronic
924569472 1:245225280-245225302 AACCAAGGAGAAGGGTCCTGGGG + Intronic
1062904732 10:1172125-1172147 TGTGAAGGAGATGGGGCCTGTGG + Intergenic
1063943763 10:11157458-11157480 AGCCAAGGGGATTGGGCATTTGG - Intronic
1063996489 10:11624906-11624928 AGCCTAGGAGATGGAGGTTGTGG + Intergenic
1064023725 10:11829919-11829941 AGCCCAGGAGGTGGAGGCTGCGG - Intronic
1064151513 10:12869544-12869566 AGCTAAGGAGTTGGAGGCTGTGG - Intergenic
1064730143 10:18322076-18322098 AGCCCAGGAGTTGGAGGCTGTGG + Intronic
1064946256 10:20793629-20793651 AGCCTGGGAGATGGAGGCTGCGG - Intronic
1065137400 10:22685641-22685663 AGCCCAGGAGATTGAGGCTGTGG + Intronic
1065309770 10:24404033-24404055 AGCCTGGGAGATGGGGGCTATGG - Intronic
1065617070 10:27538007-27538029 GGCCAAGGAGGAGGAGCCTGTGG + Exonic
1066458221 10:35590132-35590154 AGCCCAAGAGATTGGGTCTGCGG + Intergenic
1067831650 10:49614204-49614226 AGCGAAGAAGAGGGGGCTTGGGG + Exonic
1068569944 10:58617468-58617490 AGATAAGGCCATGGGGCCTGAGG + Intronic
1069138638 10:64796790-64796812 AGCCAAAGAGGAGGGGCCAGAGG + Intergenic
1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG + Intronic
1071297762 10:84234495-84234517 AGGCAAGGAGCTGGGTCCAGAGG - Intronic
1071463672 10:85920993-85921015 AGCCAGGCAGATGGGCCCAGTGG - Intronic
1072039630 10:91594578-91594600 AGCCATGGAAATGGTCCCTGTGG + Intergenic
1072302393 10:94073828-94073850 AACCAAGGAGATGGGAGATGAGG + Intronic
1072407437 10:95168513-95168535 AGGAAAGGGGATGGGGACTGGGG + Intergenic
1072527004 10:96281065-96281087 AGCCCAGGAGATTGAGACTGAGG - Intergenic
1072564507 10:96606422-96606444 AGTCATGGAGCTGGTGCCTGTGG - Intronic
1072644072 10:97238282-97238304 AGCCCAGGAGTTTGGGGCTGCGG - Intronic
1072671957 10:97436936-97436958 AACCAAGGAGGTGGAGGCTGTGG + Intronic
1072716784 10:97757531-97757553 ACCCAAGGAAACTGGGCCTGGGG - Intronic
1073271886 10:102271827-102271849 AGCCCAGGAGGTGGAGACTGTGG - Intronic
1073435075 10:103511290-103511312 AGGCCAAGAGAGGGGGCCTGGGG - Intronic
1073473782 10:103739877-103739899 AGCGAAGGAGTGGGGGCCTCCGG + Intronic
1074350625 10:112733394-112733416 ATCCACGGAGACGGGGGCTGGGG - Intronic
1074586517 10:114772527-114772549 AGCCCAGGAGATTGAGGCTGCGG + Intergenic
1074914193 10:117939814-117939836 AGCCCAGGAGATGGAGGCTGTGG + Intergenic
1075781835 10:125022272-125022294 AGGCACCAAGATGGGGCCTGTGG - Intronic
1076230530 10:128816822-128816844 AGAGAGGGAGCTGGGGCCTGTGG + Intergenic
1076624420 10:131812788-131812810 TGCCTGGGAGGTGGGGCCTGCGG - Intergenic
1076705680 10:132300271-132300293 AGCCAAGGAGATGGTGTAGGTGG - Intronic
1076775166 10:132691489-132691511 AGCCAAGGAGCTGGTGCGTCAGG + Intronic
1077235311 11:1479304-1479326 AGGCATGGAGATGGGTCCTGAGG - Intronic
1077243184 11:1522277-1522299 AGCCCAGGAGGTCGGGGCTGCGG - Intergenic
1077321473 11:1944515-1944537 ACTCAAGGAGAGGGGGTCTGTGG + Intergenic
1077361087 11:2140400-2140422 AGCCAAGGGGAAGGGGCCGCCGG + Intronic
1077711164 11:4538521-4538543 AGCCCAGGAGGTTGGGGCTGTGG + Intergenic
1077724597 11:4661521-4661543 AGCCAAGGTGATGGGCAGTGTGG + Intergenic
1077913540 11:6595350-6595372 AGCCAAAAAGATAGGGGCTGTGG + Exonic
1078258638 11:9683336-9683358 AGCCCAGGAGGTCGAGCCTGTGG + Intronic
1078287451 11:9971599-9971621 AGCCTGGGAGATGGAGGCTGTGG + Intronic
1078323015 11:10353902-10353924 AGCCCAGGAGATTGAGGCTGCGG - Intronic
1078470909 11:11585906-11585928 ACCCAGGGAGGTGGGGCCTTCGG + Intronic
1079556311 11:21761876-21761898 AGACAAGGAGAAGGGGCAAGGGG + Intergenic
1080824148 11:35833694-35833716 AGCCAATGAGTTGGGGGGTGGGG + Intergenic
1083186341 11:61019950-61019972 AACCAAGGAGCTGGGGCCCAAGG + Exonic
1084191019 11:67498813-67498835 AGCCGGGGAGCTGGGGGCTGAGG - Exonic
1084287794 11:68142993-68143015 GGCCAATGAGATGCAGCCTGGGG - Intergenic
1084447631 11:69212941-69212963 AGCCACGGAGCTGGGGGCTGGGG + Intergenic
1084500151 11:69530492-69530514 AGCCATGGGGGAGGGGCCTGGGG + Intergenic
1084561368 11:69907333-69907355 AGCCAGTGGGATGGAGCCTGGGG + Intergenic
1084957306 11:72698157-72698179 AGCCAAGGAGCTGGGGCATTGGG - Intronic
1085181787 11:74542606-74542628 AGACAAGGCCATGGGGCCTGAGG + Intronic
1085232854 11:74988245-74988267 AGCCCAGGAGTTGGAGGCTGTGG - Exonic
1085265374 11:75235087-75235109 AGGCAGGAAGTTGGGGCCTGAGG - Intergenic
1089262328 11:117231884-117231906 GACCAAGGAGATGGGGCCCCAGG - Intronic
1089414457 11:118275674-118275696 AGCCCAGGAGGTGGAGGCTGCGG - Intergenic
1089521094 11:119064089-119064111 AGCCTAGGAGGTGGAGACTGTGG + Intergenic
1089982280 11:122782161-122782183 AGCCCAGGAGGTGGAGGCTGTGG + Intronic
1090699096 11:129278966-129278988 GGCCGGGGAGATGGGGCCGGGGG + Intronic
1090965291 11:131592807-131592829 GGCCAGGGAGAGGGGACCTGGGG - Intronic
1091541451 12:1466206-1466228 CACCAAGGAGAGGGGGCCTCAGG - Intronic
1091674827 12:2481550-2481572 TTCCAGGGAGATGGGGCCTTGGG - Intronic
1092245936 12:6864210-6864232 AGCTAAGGACATGGGGCCAGTGG + Intronic
1093097624 12:14989824-14989846 TGCCATGGACATGGGGCCTGTGG - Intergenic
1093459423 12:19394898-19394920 AGCCCAGGAGATGAAGGCTGCGG + Intergenic
1093771554 12:23023549-23023571 TGCCAAGGAGCTGGGTCCTTAGG + Intergenic
1095953112 12:47792042-47792064 AGCCAAGGCCATGGGGCGTGAGG - Intronic
1096046728 12:48568979-48569001 AGCCAAGGCAATGAAGCCTGAGG + Intronic
1096235292 12:49922223-49922245 AGGCAAGGGGCTGGGGACTGGGG + Intergenic
1096404478 12:51333469-51333491 AGCCCAGGAGATTGGGACTGTGG - Intronic
1096419538 12:51445246-51445268 AGCCCAGGAGGTGGAGGCTGTGG - Intronic
1097044363 12:56176452-56176474 AGCCAAGCAGGTTTGGCCTGAGG + Intronic
1097762386 12:63482612-63482634 AGCCAAGGAGGTGGAGGTTGTGG - Intergenic
1098097149 12:66970585-66970607 GGCCAAGGAGAGGGGGTCTCAGG - Intergenic
1098293402 12:68980420-68980442 AGCCAAGCAGAGGGGTGCTGTGG - Intergenic
1098559669 12:71858148-71858170 AACCCAGGAGATGGAGGCTGCGG - Intronic
1098997029 12:77132787-77132809 AGCCCAGGAGGTGGAGGCTGTGG - Intergenic
1099034235 12:77565303-77565325 AGGCAAGGTGAAGTGGCCTGTGG - Intergenic
1099989665 12:89708930-89708952 AGCCGAGGAGGCGGGTCCTGCGG - Intronic
1100284877 12:93155798-93155820 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
1101609698 12:106279316-106279338 ACCCCATGAGATGGGGCCAGGGG - Intronic
1101646307 12:106633867-106633889 AGGCAAGGAACTGGGACCTGGGG - Intronic
1102472238 12:113165826-113165848 GGCCAAGGAGATGGACCTTGTGG - Exonic
1102955096 12:117054039-117054061 TGCCAAAGAGGAGGGGCCTGTGG - Intronic
1103324191 12:120109520-120109542 AGCCTAGGAGTTGGAGGCTGTGG - Intronic
1103369609 12:120408822-120408844 AACCAAGGAGATAGGTCCTGTGG + Intergenic
1104665018 12:130641751-130641773 AGCCAAGCATAAGGGGCATGAGG - Intronic
1104808819 12:131607444-131607466 GTCCAAGGACATGGGGCCTATGG + Intergenic
1104894323 12:132154356-132154378 AGCCAGGGAGAGGGGACCTCAGG - Intergenic
1105220806 13:18323998-18324020 AGCCAAGGTCCAGGGGCCTGAGG - Intergenic
1106780247 13:33052032-33052054 AGCCCAGGAGATGGAGGCTTCGG - Intronic
1107135986 13:36944776-36944798 AGCCCAGGAGTTTGGGGCTGTGG - Intergenic
1107907761 13:45077092-45077114 AGCCCAGGAGGTGGAGGCTGTGG + Intergenic
1107954716 13:45499938-45499960 AGCCCGGGAGATGGAGGCTGGGG + Intronic
1107979085 13:45717019-45717041 AGCCAAGGAGGTTGAGGCTGTGG + Intergenic
1107994924 13:45850576-45850598 AGTCAGGGAGGTGGGGGCTGGGG - Intronic
1108393965 13:49975187-49975209 AGCCAGGGAGATGGAGGCTGCGG - Intergenic
1109698330 13:65992137-65992159 AGCCAAGGAGATGGGAGCTCAGG - Intergenic
1110238278 13:73238855-73238877 AGCCAGGGAGGTTGGGCCTGCGG - Intergenic
1110471205 13:75862202-75862224 AGCCCAGGAGATTGAGGCTGTGG - Intergenic
1112076801 13:95922743-95922765 AGCCCAGGAGTTGGGTGCTGTGG + Intronic
1113221857 13:108113486-108113508 AGCTAAGTTGATGGGTCCTGTGG + Intergenic
1113649407 13:112025308-112025330 AGCAAAAGAGATGGGGCAGGGGG + Intergenic
1113761803 13:112853140-112853162 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
1113918595 13:113890257-113890279 AGCCCAGGAGATTGGGTCTGTGG - Intergenic
1114065047 14:19053431-19053453 AGCCAAGGAGACTGGGCCGAGGG + Intergenic
1114097214 14:19346571-19346593 AGCCAAGGAGACTGGGCCGAGGG - Intergenic
1115029112 14:28773963-28773985 GGCCAAGGAGCTGGGGGCGGAGG - Intronic
1116661830 14:47719915-47719937 AGGCAAGAAGATAGGGCATGGGG + Intergenic
1117083758 14:52178668-52178690 AGCCCAGGAGATCGAGGCTGTGG - Intergenic
1117337173 14:54765650-54765672 AGCAAAGGTGAGGAGGCCTGGGG - Intronic
1117692980 14:58327747-58327769 AGCCCAGGAGGTGGAGGCTGCGG - Intronic
1118231667 14:63957344-63957366 AACCAAGGAGATGGAAGCTGCGG - Intronic
1118364790 14:65085699-65085721 AGGCAAGGAGCTGGAGACTGAGG + Intronic
1118475048 14:66108974-66108996 AGCCTGGGAGAGGAGGCCTGAGG - Intergenic
1118605324 14:67498741-67498763 AACCCAGGAGATGGAGGCTGCGG - Intronic
1118760559 14:68878314-68878336 CCCCAAGGACATGGGCCCTGGGG + Intronic
1119129911 14:72162508-72162530 AGTCCAGGAGATGGTCCCTGAGG + Intronic
1119393295 14:74306246-74306268 AGCCCAGGAGATGGAGGCTGCGG - Intronic
1119442472 14:74637496-74637518 AGCCAAGTAGGTGGGGCTGGGGG + Intergenic
1119561625 14:75594795-75594817 AGCCCAGGAGGTTGGGGCTGAGG - Intronic
1119820275 14:77609811-77609833 AGCCCAGGAGGTGGAGGCTGCGG + Intronic
1120307540 14:82789579-82789601 AGCGAAGGAGAAGGTCCCTGGGG + Intergenic
1121139258 14:91526445-91526467 AGCCGAGGAGATGAGGCCCAGGG - Intergenic
1121314597 14:92953442-92953464 AGCCAAGAAGAGGGAGTCTGTGG + Intronic
1122042845 14:99001512-99001534 GGCCAATGAGATGTGGCATGAGG + Intergenic
1122715286 14:103693256-103693278 AGCCACCGAGAAGGGGGCTGGGG - Intergenic
1123789760 15:23709069-23709091 GGCCAAGGAGATTGGGCTTAGGG + Intergenic
1124202962 15:27694052-27694074 AGTGTTGGAGATGGGGCCTGGGG + Intergenic
1125745900 15:41997017-41997039 ATCCATGGAGGTGGCGCCTGGGG + Intronic
1126385145 15:48086669-48086691 AGCCAAGGCGAGGAGGCCAGTGG + Intergenic
1126495237 15:49282821-49282843 AGCCAAAGACATGAGGCATGAGG + Intronic
1126585771 15:50284461-50284483 GGCCAAGGAGATGGAGCTTTAGG - Intronic
1127108477 15:55642993-55643015 AGCCCAGGAGGTGGAGACTGTGG + Intronic
1127445118 15:59054011-59054033 AACCCAGGAGATGGAGGCTGCGG - Intronic
1128891003 15:71331713-71331735 AGTCCTGGAGATGGGCCCTGAGG - Intronic
1128944290 15:71810826-71810848 CTCCAGGCAGATGGGGCCTGGGG + Exonic
1129123451 15:73417975-73417997 ATCCAAGGATGTGGGACCTGTGG - Intergenic
1129320214 15:74770535-74770557 AACCTAGGACCTGGGGCCTGGGG + Intergenic
1129363927 15:75042980-75043002 GGCCAAGGCGCTGGGGGCTGGGG - Intronic
1129606638 15:77028301-77028323 AGCCCAGGAGGCGGGGCCCGGGG + Intronic
1129738860 15:77980183-77980205 GGCCAAGGACATGGGCCCAGGGG - Intergenic
1129869018 15:78929111-78929133 AGCCAGGAAGATGGGGCAGGTGG + Intronic
1130339368 15:82986290-82986312 AGCCCAGGAGAGGTGGCCTCTGG - Exonic
1130411529 15:83653033-83653055 ACCCAAGGAAATGGCGACTGTGG + Intergenic
1130442874 15:83973160-83973182 TGCCAAGGTGATGGGGTCAGTGG - Intronic
1130650875 15:85761419-85761441 AGCTAAGGAAATGGGGACTCAGG + Intronic
1131200229 15:90389293-90389315 AGGTAAGGAGAAGGGGCCTGGGG + Intronic
1131874757 15:96792972-96792994 AGCCATGGATCTGGGGCTTGTGG - Intergenic
1132585426 16:704117-704139 ATGCAAGGAGATGGGGTCTTCGG + Intronic
1132761257 16:1509578-1509600 AGCCATGGGAAAGGGGCCTGGGG - Intronic
1132833869 16:1942888-1942910 ACCCGAGGAGAGGGGGCCTTGGG - Intronic
1132959083 16:2612317-2612339 AGCCCAGGAGGCAGGGCCTGTGG + Intergenic
1132972143 16:2694292-2694314 AGCCCAGGAGGCAGGGCCTGTGG + Intronic
1133179214 16:4039959-4039981 AGCCCAGGAGGTAGGGGCTGCGG + Intronic
1133509056 16:6440309-6440331 AATAAAGAAGATGGGGCCTGTGG + Intronic
1133537320 16:6714503-6714525 ACCCAAGGGCAGGGGGCCTGGGG + Intronic
1133774360 16:8885767-8885789 AGCCCAGGAGATGGGGTCTTTGG - Intergenic
1133987515 16:10679817-10679839 AACCCAGGAGATGGAGGCTGTGG + Intronic
1134118812 16:11569316-11569338 GGCCCAGGAGTTGGAGCCTGTGG - Intronic
1134330042 16:13242330-13242352 ATCCGAGGAGATGGGGCCCAGGG + Intergenic
1134891176 16:17843026-17843048 AGCCCAGGAGATCGAGGCTGTGG + Intergenic
1135075561 16:19390433-19390455 AGCCAAGGAGATGGGAGCTCAGG - Intergenic
1135399124 16:22153815-22153837 AGCCCAGGAGGTGGAGGCTGTGG - Intronic
1135509968 16:23073940-23073962 AGCCAAAGAGATGGTGTCTGTGG - Intronic
1135632546 16:24047451-24047473 AGCCCAGGAGTTGGTGGCTGCGG + Intronic
1137286552 16:47020902-47020924 AGCCAAGGCGATGGATCATGAGG - Intergenic
1138315116 16:56063080-56063102 AGCCAACCAGATTTGGCCTGTGG - Intergenic
1138420274 16:56894541-56894563 GGCCAAGGAGATAGGGAATGAGG - Exonic
1138565071 16:57827285-57827307 AGACACTGAGATGTGGCCTGTGG - Intronic
1139638049 16:68270934-68270956 AGCCAAGGAGGTCAGGGCTGCGG - Intronic
1139804280 16:69550801-69550823 AGCCCAGGAGATCGAGGCTGTGG - Intergenic
1139921583 16:70463848-70463870 GGCCAAGGCGATGGAGCCAGAGG - Intronic
1139955468 16:70691067-70691089 AGCCAAGGGGTTGAGGCCTCTGG - Intronic
1140889149 16:79270360-79270382 AGTCAAGGAGATGTGGCCAAGGG + Intergenic
1141389119 16:83649678-83649700 AGGCAAAGGGAGGGGGCCTGTGG + Intronic
1141754385 16:85981767-85981789 AGCCCAGGAGTTGGAGGCTGCGG + Intergenic
1141995189 16:87632515-87632537 AGCCCAGGAGATTGAGGCTGCGG - Intronic
1142186268 16:88696164-88696186 AGCCCAGGAGATCGAGGCTGTGG + Intergenic
1142311671 16:89317693-89317715 AACCCAGGAGCTGGAGCCTGAGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142721632 17:1780143-1780165 AGCCTAGGATATGAGGGCTGAGG - Exonic
1142887905 17:2924623-2924645 AGCGAATGAGATGGGGCTGGTGG + Intronic
1143049739 17:4115097-4115119 AGCCTAGGAGATCGAGGCTGCGG - Intronic
1143699895 17:8650625-8650647 AGTGAAGGGGATGGGGGCTGAGG - Intergenic
1143700792 17:8658698-8658720 ATCCAAGGAGTTGGGGCAGGCGG - Intergenic
1143714051 17:8754495-8754517 AGCCTAGGAGATGGAGGCTGCGG + Intronic
1143780405 17:9226029-9226051 GGCCCATGAGAAGGGGCCTGTGG + Intronic
1144788679 17:17845667-17845689 AGCCAAAGGGCTGGGGCCTCTGG + Intronic
1144852341 17:18250433-18250455 TGCCAAGGAGGTGGGGCCAAGGG - Intronic
1145769209 17:27480194-27480216 AGGCAAGGGGAGGAGGCCTGGGG - Intronic
1145894570 17:28446703-28446725 AGCCCAGGAGATTGAGGCTGCGG - Intergenic
1146618007 17:34372034-34372056 GGCCTAGGAGATGGGGTGTGGGG - Intergenic
1146848074 17:36197269-36197291 AACCCAGGAGGTGGGGGCTGTGG + Intronic
1146947761 17:36885329-36885351 AGATAAGGAGATGGAGGCTGAGG - Intergenic
1146983122 17:37184769-37184791 AGCCAAGGAGGTCGAGGCTGTGG + Intronic
1147238703 17:39076431-39076453 AGCCCAGGAGTTGCGGGCTGTGG + Intronic
1147260997 17:39209832-39209854 CGCCAAGGAGAGGCGGGCTGCGG - Intergenic
1147634878 17:41957715-41957737 ATGCAAGGTGATGGGGGCTGGGG - Intronic
1148713942 17:49702196-49702218 AGCCCAGGAGGTGGAGGCTGAGG - Intronic
1148794759 17:50191677-50191699 AGCCATGGAGATAGGGTGTGGGG - Intronic
1148855125 17:50574835-50574857 AGGCGTGGAGATGGGGACTGGGG + Intronic
1149143410 17:53460679-53460701 AGCCCAGGAGGTGGAGGCTGTGG + Intergenic
1149662547 17:58342506-58342528 AGCCAAAGAGATGGAGGCAGTGG - Intergenic
1149693684 17:58599588-58599610 AGACATGGATCTGGGGCCTGAGG + Exonic
1149781820 17:59403623-59403645 AGCCCAGGAGGTGGAGGCTGCGG - Intergenic
1150386434 17:64765318-64765340 GGCGGAGGAGATGGAGCCTGGGG - Intergenic
1150918228 17:69457725-69457747 AGCCCAGGAGATAGAGGCTGTGG + Intronic
1151025305 17:70670487-70670509 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1151862889 17:76778878-76778900 AGCCCAGGAGATTGAGGCTGCGG + Intronic
1151951401 17:77356279-77356301 AGGCAGGGAGATGGGGCTGGAGG - Intronic
1152136779 17:78508877-78508899 AGCTCAGGAGATGGAGGCTGCGG - Intronic
1152149125 17:78588100-78588122 AACCCAGGAGATGGGGGTTGTGG + Intergenic
1152224856 17:79088000-79088022 TGCCAAGGATATGGGGCAGGAGG + Intronic
1152376644 17:79921983-79922005 AGCCCAGGAGTTGGGGCTGGGGG + Intergenic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1152853526 17:82650556-82650578 AGCCCAGGAGATTGAGGCTGAGG + Intergenic
1152862359 17:82703660-82703682 AGACAATAAGGTGGGGCCTGAGG - Intergenic
1153249459 18:3106743-3106765 AGCCTGGGAGATGGAGGCTGTGG + Intronic
1153527284 18:6009224-6009246 AGTCCAGGAGTTGGGGCCTCAGG + Intronic
1156313082 18:35942602-35942624 AGCCCAGGAGATTGAGGCTGGGG - Intergenic
1157230345 18:45909866-45909888 AGCCCAGGAGTTTGGGGCTGAGG + Intronic
1158484983 18:57858124-57858146 AGATTAGGAGATGGGGCCTTTGG + Intergenic
1158485335 18:57861237-57861259 AGCCCAGGGGGTGGAGCCTGGGG - Intergenic
1158862858 18:61610007-61610029 AGCAAAGGAAAAGGGGCTTGGGG - Intergenic
1158883849 18:61806738-61806760 AGCGAAGGAGAGGGGGTCTTGGG - Intergenic
1158994481 18:62903690-62903712 AGCCCAGGAGGTGGAGGCTGCGG + Intronic
1159545861 18:69839186-69839208 AGCTAAGGAGATGAGGCTCGGGG - Intronic
1159781785 18:72668255-72668277 AGTCCAGGAGATGGGACCCGGGG + Intergenic
1160194017 18:76738016-76738038 AGTCAAGGAGAGGAAGCCTGAGG - Intergenic
1160810965 19:1012790-1012812 AGCCAGGGAGAGGGGGCCACGGG - Intronic
1160903619 19:1441403-1441425 AGCCAGGCAGATGGGGGCAGGGG + Intergenic
1160952500 19:1674421-1674443 TGCCAAGGAGATGGCCCTTGGGG - Intergenic
1160982791 19:1823884-1823906 AGCCAGGGAGGTGGTGCCTCCGG - Intronic
1161183280 19:2899936-2899958 AGCCAAAGTGCAGGGGCCTGTGG + Intergenic
1161263636 19:3352252-3352274 AGCCCAGGAGTTGGAGGCTGCGG + Intergenic
1161414459 19:4137814-4137836 AGCCAAGGAGTTGGAAGCTGCGG - Intergenic
1161497671 19:4596466-4596488 GGCCAGGGAGGAGGGGCCTGGGG + Intergenic
1161863593 19:6817762-6817784 AGCCCAGGAGGTGGAGGCTGCGG - Intronic
1161863931 19:6820311-6820333 AGCCCAGGAGTTCGAGCCTGCGG - Intronic
1161869585 19:6859972-6859994 AGCCCAGGAGGTGGAGGCTGTGG + Intergenic
1162460959 19:10813746-10813768 AGCCCAGGAGATGGAGGCTGTGG + Intronic
1162463517 19:10827489-10827511 AGCCCAGGAGATCGAGGCTGCGG + Intronic
1162496231 19:11024789-11024811 AGCCAGGCAGGTGGGGCCTGGGG - Intronic
1162828049 19:13266282-13266304 AGCCCAGGAGTTGGAGGCTGCGG - Intronic
1162997074 19:14342982-14343004 CGCCCAGGAGATGGAGCCCGTGG - Intergenic
1163033097 19:14557028-14557050 GTCCCAGGAGAAGGGGCCTGTGG + Intronic
1163238928 19:16046981-16047003 AGGCAGGCAGATGGCGCCTGAGG + Intergenic
1163274366 19:16273886-16273908 AGCCCAGGAGTTGGAGGCTGTGG - Intergenic
1163424475 19:17233786-17233808 GGCCAAGGAGATGGGTTCTAAGG + Intronic
1163638883 19:18450552-18450574 AGACAAGGAGAGGGCGGCTGAGG - Exonic
1164969946 19:32523282-32523304 TGCCATGGAGATGAGGTCTGGGG - Intergenic
1165010218 19:32840594-32840616 GGTCAAGGAGCTGGAGCCTGTGG - Intronic
1165145876 19:33729756-33729778 CCCCAAGGAGTTTGGGCCTGGGG + Intronic
1165846164 19:38819026-38819048 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
1166135679 19:40775746-40775768 AGCCATGGAGATAGGGTCTAGGG - Exonic
1166548541 19:43649460-43649482 AGCTCAGGAGATGGAGGCTGTGG + Intronic
1166670087 19:44704358-44704380 AGGCCAGGAGAGGGGGCCTAAGG + Intronic
1166824178 19:45599093-45599115 ACCCAAGAAGTGGGGGCCTGTGG - Intronic
1166957890 19:46477786-46477808 AGCCCAGGAGATGAAGGCTGCGG - Intergenic
1167298676 19:48666759-48666781 AGCCCAGGAGTTGGAGGCTGTGG - Intronic
1167428160 19:49440276-49440298 GGCCAAGGGGACAGGGCCTGAGG + Intronic
1167596685 19:50432017-50432039 AGCCGAGGGGGCGGGGCCTGGGG - Intergenic
1167741117 19:51325549-51325571 GGCCAGGGAGAAGGGGGCTGGGG - Intronic
1167844176 19:52146985-52147007 AGAAAAGGAGATGTGGCCTAGGG - Intergenic
1168275359 19:55274892-55274914 AGCCAAGGAGAGGGGGGCTCAGG + Intronic
926030203 2:9579892-9579914 AGCCCAGGAGTTTGGGGCTGTGG - Intergenic
927683308 2:25154359-25154381 CCTCAAGGAGATGGGGTCTGAGG + Exonic
927980692 2:27373149-27373171 AGCCCAGGAAATGGGGTCGGGGG + Intronic
928179959 2:29062120-29062142 TGCCAAGGTGCTGGGGGCTGGGG - Exonic
928183327 2:29086632-29086654 AGCCCAGGAGGTGGAGGCTGTGG - Intergenic
929193724 2:39164038-39164060 AGACCAGGAGATGGAGGCTGCGG - Intergenic
929818219 2:45252994-45253016 AGCTAAGCAGATGCGGCGTGGGG - Intergenic
931057903 2:58493343-58493365 AGCCCAGGAGTTTGGGGCTGCGG + Intergenic
931219131 2:60273420-60273442 AGAGAACGAGATGGGGCCTGTGG + Intergenic
931276041 2:60744743-60744765 AGATAAGGTCATGGGGCCTGAGG - Intergenic
931643891 2:64404456-64404478 AGCCAATGAGTTGGGGGCAGGGG + Intergenic
932705186 2:74019177-74019199 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
933090211 2:78108790-78108812 AGATAAGGTCATGGGGCCTGAGG - Intergenic
933669482 2:84993107-84993129 AGCCCAGGAGGTGGAGGCTGTGG + Intronic
933778473 2:85785995-85786017 GGGCAAGGTCATGGGGCCTGTGG - Intronic
934183249 2:89648478-89648500 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
934293530 2:91722648-91722670 AGCCAAGGTCCAGGGGCCTGAGG + Intergenic
934753138 2:96807132-96807154 ACCCAAGGAGCTGGGGCCACAGG + Intronic
934781398 2:96971863-96971885 AGCCAAGGAGAAGAGGCCAAGGG + Intronic
935223610 2:101035292-101035314 AGCAAAGGAGCTTGGGCCCGAGG - Intronic
935260526 2:101351961-101351983 AGCCCAGGAGATCGAGGCTGCGG - Intronic
936104262 2:109611681-109611703 AGCCCAGGAGATTGAGGCTGAGG + Intronic
936348252 2:111691547-111691569 AGCCTGGGAGAGGGGGCCTCAGG - Intergenic
937023588 2:118679838-118679860 AGCCAAGGAGACTGGGCATCAGG + Intergenic
937924151 2:127154663-127154685 GGCCAAGGAGCTGAGTCCTGGGG + Intergenic
937956003 2:127422179-127422201 AGTCAAGGAGGTGGAGGCTGAGG - Intronic
938399529 2:130977891-130977913 AGCCAAGGAGGTGGGAGCTCAGG + Intronic
938482299 2:131672434-131672456 AGCCAAGGAGACTGGGCCGAGGG + Intergenic
938569174 2:132546539-132546561 TGCCTAAGAGAAGGGGCCTGGGG + Intronic
938817240 2:134917572-134917594 AGCCCAGGAGGTGGAGGCTGCGG - Intergenic
939108490 2:137977922-137977944 AGCCCTGGAGATGGGGGGTGGGG - Intronic
939203451 2:139069121-139069143 ATCAAAGGACATGGGGCCAGTGG + Intergenic
939333798 2:140799232-140799254 CCCTAAGGAGATGGGGCCTTTGG + Intronic
939491303 2:142880308-142880330 AGCCAAGAAGATGGGTCCCCTGG + Intronic
941044167 2:160653539-160653561 AGCTGAGGAGATAGGGACTGAGG + Intergenic
942451291 2:176109207-176109229 ACCCAAGGACAGTGGGCCTGCGG - Exonic
943706487 2:191040637-191040659 AGCCCAGGAGGTGGAGGCTGCGG - Intronic
946288562 2:218725295-218725317 AGCCCAGGAGATGGAGGCTGTGG - Intronic
946302050 2:218830102-218830124 AGCTTGGGAAATGGGGCCTGCGG + Exonic
946352826 2:219166610-219166632 AGCCCAGGAGTTGGAGGCTGCGG - Intronic
947437510 2:230085229-230085251 GGCCACTGAGATGGGGCCTGGGG - Intergenic
947589013 2:231374202-231374224 ATCCAAGCAGATGGCGCCTAAGG + Intronic
947668525 2:231922498-231922520 AGCAAAGCAGAAGGGGCCTGGGG - Intronic
948110145 2:235448456-235448478 AGGCAAAGAGATGGGGACAGTGG - Intergenic
948856178 2:240731740-240731762 AGCCAGGGCGAGGGGGACTGTGG - Intronic
1168962400 20:1878192-1878214 AGACAGGGAGATGGGAACTGTGG + Intergenic
1169018920 20:2314090-2314112 AGCCAAGGAGGTGGAGATTGTGG + Intronic
1169248023 20:4039014-4039036 AGGCAAGAAGAGGGGGACTGCGG + Intergenic
1169259170 20:4122746-4122768 AGCCCAGGAGGTGGGGGTTGCGG + Intronic
1169394489 20:5217561-5217583 GGGCTAGGAGCTGGGGCCTGGGG + Intergenic
1169514775 20:6303851-6303873 AGCCTAGGAAATGCAGCCTGCGG + Intergenic
1169689232 20:8311756-8311778 GGCCAAGGAGGTGGTGGCTGAGG + Intronic
1170194292 20:13674616-13674638 GGCTGAGGAGATGTGGCCTGAGG - Intergenic
1170258521 20:14375563-14375585 AGCAAAGAAGATGGGGGTTGGGG + Intronic
1170368741 20:15625295-15625317 AGCCCAGGACATGTGGACTGTGG + Intronic
1170548181 20:17452752-17452774 CCCCAAGGCAATGGGGCCTGGGG - Intronic
1171466961 20:25336610-25336632 CGCCGAGGAGGTGGGGTCTGTGG - Intronic
1171935802 20:31274118-31274140 AGCCCAGAAGAAGGGGCGTGGGG + Intergenic
1172786069 20:37469668-37469690 TGCCAAGGAGAAGAGGCCTGGGG - Intergenic
1172881615 20:38203435-38203457 TTGCAAGGAGATGGGGGCTGCGG + Intergenic
1173040770 20:39460260-39460282 AGAGAAAGAGATGGGGCATGGGG + Intergenic
1173310652 20:41893558-41893580 AGCCCAGGATCTGGGGCCAGAGG - Intergenic
1173408502 20:42788487-42788509 GGCCAAGGAGATGAGGCTGGGGG + Intronic
1173762485 20:45575816-45575838 AGCCATGGAAACAGGGCCTGGGG - Intronic
1173951027 20:46993364-46993386 AGCAAAGGAAAAGGGGCCAGGGG - Intronic
1174005394 20:47406851-47406873 AGCCCAGGAGGTGGAGGCTGTGG + Intergenic
1174102899 20:48140535-48140557 AACCAAGGAGATGTGGCCAACGG - Intergenic
1174358827 20:50015461-50015483 TGCCAAGGAAATGGGCCCGGAGG - Intergenic
1174397370 20:50255929-50255951 AGCCTAGGAGTTGGAGGCTGCGG - Intergenic
1174684176 20:52437763-52437785 TGGCAAGGAGATGAGGGCTGAGG - Intergenic
1174724393 20:52845975-52845997 AGCAAGGCAGATGGAGCCTGTGG + Intergenic
1175188574 20:57196322-57196344 AGCCATGCAGATGAGGTCTGAGG - Intronic
1175257509 20:57656210-57656232 AGCCCAGCACAAGGGGCCTGGGG + Intronic
1175277632 20:57782996-57783018 TGCCAGGGAGCTGGGGCCTCTGG + Intergenic
1175315840 20:58045992-58046014 AGGGAAGGAAATGGGGCCTCAGG - Intergenic
1175597910 20:60250151-60250173 AGCAAAGGAGAGGGGGACAGTGG - Intergenic
1175672147 20:60912730-60912752 AACCCAGGAGATGGAGCTTGTGG + Intergenic
1175730853 20:61353016-61353038 AGGGGAGGAGATGGGGCCCGTGG - Intronic
1175806857 20:61834303-61834325 GGCCTAGGATCTGGGGCCTGGGG + Intronic
1175853638 20:62107230-62107252 AGACAAGGAGAGGGTGCATGAGG - Intergenic
1175930194 20:62490208-62490230 ATCCAAGAACATGGGCCCTGGGG + Intergenic
1175991036 20:62789222-62789244 AGGCCAGGTGATGGGCCCTGGGG + Intergenic
1176248118 20:64107019-64107041 GGTCAAGGACATGGGGCCAGAGG + Exonic
1176267328 20:64217020-64217042 AGCCAGTGAGATGGGACCTGGGG - Intronic
1176296393 21:5075674-5075696 AGCCAAGGAGCTCATGCCTGTGG + Intergenic
1176409614 21:6441378-6441400 AGCCAGGGAGATTGAGGCTGCGG - Intergenic
1176426253 21:6550168-6550190 TTCCAAGAAGAGGGGGCCTGGGG - Intergenic
1177900175 21:26905061-26905083 AGCCACCAAGCTGGGGCCTGGGG + Intergenic
1178019803 21:28395517-28395539 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1178246328 21:30956444-30956466 AGCCAAGCAGATGCTGCCTGTGG + Intergenic
1178286263 21:31327975-31327997 AGCCAAGGAGATGAAGACAGAGG - Intronic
1178354215 21:31897166-31897188 AGCCTAGGAGGTGGAGGCTGCGG + Intronic
1178355869 21:31910260-31910282 AGCCAAGGAGAGGAGGCCTCAGG - Intronic
1178426183 21:32480221-32480243 AGCCCAGGAGTTGGAGGCTGTGG + Intronic
1178673213 21:34610384-34610406 AGACCAGGAGATGGGGCATTTGG - Intronic
1178710269 21:34910846-34910868 AACCCAGGAGCTGGAGCCTGCGG - Intronic
1179210387 21:39319995-39320017 AGCCAAGGAGTTTGGGTTTGAGG - Intronic
1179685107 21:43049700-43049722 AGCCAGGGAGATTGAGGCTGCGG - Intergenic
1179701744 21:43158485-43158507 TTCCAAGAAGAGGGGGCCTGGGG - Intergenic
1179860656 21:44186447-44186469 AGCCAAGGAGCTCATGCCTGTGG - Intergenic
1179945837 21:44674637-44674659 AGCCCAGGAGGTGGAGGCTGTGG + Intronic
1180483537 22:15776051-15776073 AGCCAAGGAGACTGGGCCGAGGG + Intergenic
1180862534 22:19093926-19093948 AGCCTAGGAGTTGGAGGCTGTGG + Intronic
1180974705 22:19841971-19841993 AGCCAAGGCCATGAGGCCTGAGG + Intronic
1180981277 22:19879277-19879299 AGCCTGGGCGGTGGGGCCTGCGG - Intronic
1181129997 22:20725605-20725627 AGCCAGGGAGATGGGCACAGTGG + Intronic
1181343740 22:22202017-22202039 AGACAAGCAGCTGGGACCTGGGG + Intergenic
1182364155 22:29766722-29766744 AGGCCAGGAGCTGGAGCCTGCGG - Intronic
1183612143 22:38916304-38916326 AGACAGGGAGGTGAGGCCTGAGG + Intergenic
1183612695 22:38921273-38921295 AGCCCAGGTGATGGGGTGTGAGG + Intergenic
1183789733 22:40056718-40056740 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
1184108746 22:42383334-42383356 AGCCAAGGAGGTGGGGGCAAGGG - Exonic
1184240613 22:43209661-43209683 ACCCATGGAGCTGGAGCCTGAGG + Intronic
1184265650 22:43344344-43344366 TGTCAAGGAGATGGGCCTTGGGG - Intergenic
1184709537 22:46240440-46240462 AGTCCAGGAGATGGGAGCTGAGG - Exonic
1185054182 22:48569475-48569497 TGCCAAGGACATGGGGAGTGTGG + Intronic
1185194172 22:49458139-49458161 GGCCAAGCAGATGTGGCCAGTGG - Intronic
1185236389 22:49716022-49716044 AGCCCAGGAGGTGGAGGCTGCGG - Intergenic
949177921 3:1089249-1089271 AGCCCGGGAGATGGAGGCTGTGG - Intergenic
950111460 3:10421346-10421368 AGGGAAGGAGAAGGGCCCTGTGG - Intronic
950165945 3:10799054-10799076 TGCCTAGGAGCTGGGGACTGGGG + Intergenic
950311861 3:11965912-11965934 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
950429521 3:12942896-12942918 GGCCAAGGAGAGGGGCCATGGGG + Intronic
950500579 3:13361093-13361115 ACCAAAGGAGATGCAGCCTGTGG + Intronic
952927225 3:38328995-38329017 AGCCAACCAGATGCTGCCTGGGG - Intergenic
952990629 3:38828122-38828144 AGCCAATGAGATGAGCTCTGTGG - Intergenic
953345448 3:42171745-42171767 TGCCAAGGAGATCTGGCCAGTGG - Intronic
953583403 3:44177548-44177570 AACCAAGGGGAAGGAGCCTGGGG + Intergenic
953843126 3:46405951-46405973 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
953845123 3:46420693-46420715 AGAGAAGGCCATGGGGCCTGAGG - Intergenic
954012776 3:47656834-47656856 AGCCCAGGAGGTGGAGGCTGAGG + Intronic
954024835 3:47774881-47774903 AGCCCAGGAGATTGAGGCTGCGG - Intronic
954214355 3:49116218-49116240 AGCCAGGGAGATGGAGCCCACGG + Intronic
954379010 3:50209787-50209809 GGCCAGGGAGCTGGGGGCTGAGG + Intronic
954394233 3:50284653-50284675 AGCCCAGGAGGTGGAGGCTGCGG + Intronic
954588894 3:51762995-51763017 AGCCTAGAAGATGGGGGATGGGG + Intergenic
954640614 3:52095651-52095673 AGCCAAGGAGATGAGGAATTGGG + Intronic
954787810 3:53107718-53107740 AGCCAAGGGGATGGGGGCCCTGG - Intronic
955628386 3:60945688-60945710 AGAAAGGGAGATGGGGACTGTGG + Intronic
956229078 3:66992960-66992982 AGCAAAAGAGATGGGGCATATGG + Intergenic
956453496 3:69397302-69397324 TGCCAGGGAGTTGGGGCGTGAGG + Intronic
959539538 3:107523679-107523701 TGCCGGGGAGGTGGGGCCTGGGG + Intronic
959916342 3:111820752-111820774 AGCAAAGAAGATAGGGCCAGAGG + Intronic
960843236 3:121981540-121981562 AGCCAAGGAAAAGAGGCCTCAGG + Intergenic
962367986 3:134798278-134798300 AGGTAAGGAGATGTGGCCAGAGG + Intronic
962902805 3:139775784-139775806 AGCCACGGAGAGGGGGCCTCAGG + Intergenic
962934020 3:140062793-140062815 AGACAAGGAAATGGGCCCAGAGG - Intronic
963746288 3:149127956-149127978 AGCCAAGGAGAAGGGGCTTCAGG + Intergenic
964432755 3:156623403-156623425 AGATAAGGCCATGGGGCCTGAGG + Intergenic
964617434 3:158682955-158682977 AGCCCAGAAGATGGAGACTGTGG + Intronic
964766703 3:160186348-160186370 AGGGAAGGAGTTGGGGCCAGGGG + Intergenic
966002365 3:174965884-174965906 AGGCAAGGAGAGGGGTCCTGGGG + Intronic
966098959 3:176242931-176242953 AGCCCAGGAGGTGGGGGTTGCGG - Intergenic
966973221 3:185064199-185064221 AACCCAGGAGATGGAGCTTGCGG + Intergenic
967130429 3:186465469-186465491 AGCCAAGGAAACGGGGGCTTTGG - Intergenic
967653398 3:192014887-192014909 AGACAGAGAGATGGGGCTTGGGG - Intergenic
967849657 3:194072111-194072133 CGCCAAAGAGATGGGGAATGGGG + Intergenic
967877089 3:194274934-194274956 AGCCTATGAGATGGGTACTGTGG + Intergenic
967990590 3:195127414-195127436 TTGCAAGTAGATGGGGCCTGAGG - Intronic
969087059 4:4664305-4664327 GGCTAAGCGGATGGGGCCTGGGG + Intergenic
969255748 4:6000597-6000619 AGGCAAGGAAATGAGCCCTGTGG - Intergenic
969341476 4:6544418-6544440 AGCCCAGGAGTTTGGGGCTGCGG - Intronic
969389620 4:6881629-6881651 AGCCAAGGATTTGGGGTGTGGGG + Exonic
970823837 4:20251629-20251651 GGCCAAGGAGTTGGGGGCTGGGG + Intergenic
971177504 4:24293746-24293768 AAGCAAGGGGATGGTGCCTGGGG - Intergenic
973952792 4:56034802-56034824 AACCCAGGAGATGGAGGCTGCGG - Intergenic
974749332 4:66116130-66116152 AGCCCAGGAGATGGAGGCTGTGG - Intergenic
975328485 4:73087161-73087183 AGCCCAGTAGATGGAGGCTGGGG - Intronic
975762593 4:77633636-77633658 AGATAAGGCCATGGGGCCTGAGG - Intergenic
976204521 4:82611770-82611792 AGCCAAGGAGCTGGAAGCTGCGG + Intergenic
977138388 4:93335774-93335796 AGCCCAGGAGGTGGAGGCTGTGG - Intronic
977248465 4:94661313-94661335 AGCCAAGGAGGTGGAGGCTGCGG + Intronic
977389614 4:96391077-96391099 AGTGTTGGAGATGGGGCCTGTGG + Intergenic
977583166 4:98746861-98746883 AGCCAAGGATATGGAACCTCTGG + Intergenic
978016387 4:103751805-103751827 AGATAAGGCCATGGGGCCTGAGG + Intergenic
979082306 4:116359858-116359880 AGATAAGGCCATGGGGCCTGAGG + Intergenic
979966215 4:127079016-127079038 AGCCCAGGAGATGGAGGTTGTGG + Intergenic
981523380 4:145688121-145688143 AGCCTGGGAGATGGAGGCTGAGG + Intronic
981707068 4:147670941-147670963 AACCAAGGAGAAGGAGCCAGTGG - Intronic
981829245 4:148981276-148981298 AGCTGAAGAGATGTGGCCTGGGG + Intergenic
982304279 4:153913634-153913656 AGTCAAGGTGCTGGGGTCTGAGG + Intergenic
984977696 4:185244073-185244095 AGCCCAGGAGATGCAGGCTGCGG - Intronic
985041452 4:185895437-185895459 AGCCAAGGAGGTGAGGGCAGTGG + Intronic
985530190 5:429502-429524 AGCCAAGGACCCGGGGGCTGAGG - Intronic
986399961 5:7370906-7370928 AGCCCGGGAGATGGAGGCTGTGG + Intergenic
986402365 5:7394568-7394590 AGCCAGGGAGGCGGGGCATGGGG + Intergenic
986939878 5:12937094-12937116 AGATAAGGCCATGGGGCCTGAGG + Intergenic
987325485 5:16808393-16808415 AGCCCAGGAGTTGGAGGCTGTGG + Intronic
988810121 5:34776727-34776749 AGCCAGGGAGATTGAGGCTGTGG + Intronic
989606227 5:43246697-43246719 AGCCAAGCAAATGGGGAGTGAGG - Intronic
991531395 5:67619057-67619079 AGCCAAATAGATGGGACATGTGG - Intergenic
991658904 5:68930999-68931021 AGATAAGGCCATGGGGCCTGAGG - Intergenic
993720420 5:91316202-91316224 AGCCCAGGAGATGGAGGCTGTGG + Intergenic
995784772 5:115816458-115816480 AGCCAAGGAGCTGGGGGCGAGGG + Exonic
995884241 5:116876005-116876027 AGCCAAGGAGATTGAGGCTGCGG - Intergenic
995902856 5:117090728-117090750 AGCCAAGAAAATGGGGCCGCTGG - Intergenic
996602920 5:125287788-125287810 AGCCAAGGAAAAGGTGCCTCTGG + Intergenic
997295644 5:132766712-132766734 AGCCCAGGAGATAGGGCCAGTGG + Intronic
998459711 5:142300892-142300914 AGCCATGGAGTTGGAGCTTGCGG - Intergenic
998629357 5:143881293-143881315 GGCCAAGGAGATGAAGCATGTGG - Intergenic
999082432 5:148856919-148856941 AGGCAAGGAAATGGAGCCTCAGG + Intergenic
999105265 5:149064906-149064928 AGCCCAGGAGATGAGAGCTGGGG + Intergenic
999205516 5:149845245-149845267 AGCCAAGGAATTGGTGACTGAGG + Intronic
999353988 5:150906250-150906272 AGCCAAAATGAAGGGGCCTGCGG + Intergenic
999392471 5:151204105-151204127 AGCCAAGGAGGTTGAGGCTGTGG - Intronic
999480492 5:151943489-151943511 TGCCAAAGTGATTGGGCCTGAGG - Intergenic
1000047219 5:157531587-157531609 AGTCCAGGAGATGGAGGCTGCGG + Intronic
1000260635 5:159585197-159585219 GGCCAAGGGGAAGGGGCATGAGG - Intergenic
1000310888 5:160043513-160043535 AGCCCAGGAGGTTGGGGCTGTGG + Intronic
1001688417 5:173613811-173613833 AGGCAAGGAAATGGGGGCAGAGG + Intronic
1001988761 5:176098345-176098367 CACCAAGGAGAAAGGGCCTGCGG + Intronic
1002050702 5:176568930-176568952 AGCCAGAGAGAAGGGGCCGGTGG - Intronic
1002228107 5:177739791-177739813 CACCAAGGAGAAAGGGCCTGCGG - Intronic
1002297400 5:178239200-178239222 AGTGATGGGGATGGGGCCTGGGG + Intronic
1002575670 5:180172441-180172463 AGCCAAGGAAATGAGGGCTGAGG + Intronic
1002904961 6:1440777-1440799 AGCCAAGGAGATGGAGGTTGCGG - Intergenic
1003336238 6:5175580-5175602 TACTAAGGAGAGGGGGCCTGTGG + Intronic
1003592156 6:7445524-7445546 AGCCAAGGCCATGGGAGCTGGGG + Intergenic
1003772065 6:9316554-9316576 AGACAAGAGGGTGGGGCCTGGGG + Intergenic
1004643768 6:17540002-17540024 AGCCCAGGAGGTGGGGGCTGCGG + Intronic
1004916176 6:20334252-20334274 AGCCAAGAAGATGGGGTGGGAGG + Intergenic
1005598736 6:27405524-27405546 AGATAAGGCCATGGGGCCTGGGG - Intergenic
1005661414 6:28002637-28002659 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1005822155 6:29607062-29607084 AGCCAAGGATCTGGGGGCTGAGG + Intronic
1006031152 6:31177623-31177645 AGCCAAGGTGATTGGGCTTGGGG - Intronic
1006091969 6:31633578-31633600 GGCCTAGGAGAGGGGCCCTGAGG - Exonic
1006113102 6:31760661-31760683 AGGGAAGGAGACAGGGCCTGGGG - Intronic
1006433081 6:34010103-34010125 AGGCAAGGGGAGGGGGCCTGTGG - Intergenic
1006468235 6:34209171-34209193 AGAAAAGGAGATCGGGCATGAGG + Intergenic
1006927225 6:37663827-37663849 AGAACAGGAGATGGGGGCTGGGG - Intronic
1006950736 6:37819672-37819694 AGCCGAGGAGGAGGGGCGTGCGG - Exonic
1006983779 6:38164807-38164829 AGCCAAGCAGCTGGAGCCTACGG - Intergenic
1007341695 6:41194682-41194704 AGGCAAGGTGATGAGTCCTGGGG + Exonic
1007376963 6:41463494-41463516 AGCAATGGAGCAGGGGCCTGAGG - Intergenic
1008489806 6:52074750-52074772 AGCCAGGGAGATGGGGGAGGTGG - Intronic
1008552567 6:52647022-52647044 GGCCAAGCAGGTAGGGCCTGTGG - Intergenic
1008896711 6:56565196-56565218 AACCCAGGAGATGGAGCTTGCGG - Intronic
1010054750 6:71552004-71552026 AACCAAGGGGGTGTGGCCTGGGG + Intergenic
1010218650 6:73428144-73428166 AGCCCAGGAGATCGAGGCTGTGG + Intronic
1012373226 6:98531317-98531339 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1012544760 6:100405800-100405822 AGCTAATGAGATGTGGACTGTGG - Intronic
1013193716 6:107826637-107826659 AGGCAAGGAGGTTGGGCCTGAGG - Intergenic
1013480336 6:110547440-110547462 AGCAAAGGAAATGTGGCATGGGG - Intergenic
1014436383 6:121425273-121425295 AGCCAGGGGAGTGGGGCCTGTGG - Intergenic
1014789213 6:125652736-125652758 AACCAAGGAGATGAAGCCTTTGG - Intergenic
1014790928 6:125670968-125670990 AGTCAAGGAGATGGGAACTTAGG - Intergenic
1014824308 6:126031520-126031542 ACCTAAGGAGATGGTGCTTGAGG + Intronic
1015300021 6:131642647-131642669 AGCCCAGGAGATCGAGGCTGCGG - Intronic
1015428222 6:133097410-133097432 TCCTAAGGAGCTGGGGCCTGAGG - Intergenic
1015736992 6:136411594-136411616 GGCCATGGACACGGGGCCTGGGG + Intronic
1015971390 6:138746008-138746030 AGCCCAGGAGATGGAGGTTGCGG + Intergenic
1016150898 6:140741502-140741524 AGCCAATGAGATGAGGCATAAGG + Intergenic
1016372520 6:143390148-143390170 ATACTAGGAGGTGGGGCCTGTGG + Intergenic
1017675833 6:156812774-156812796 ATCAAGGGAGATGGGGGCTGCGG - Intronic
1017865287 6:158437863-158437885 AGCCCAGGAGTTGTGGGCTGTGG + Intronic
1018722797 6:166586593-166586615 AGCCCAGGAGAGGTGGCCTCTGG + Intronic
1018982749 6:168613206-168613228 AGCACAGGAGCTGGGCCCTGGGG + Intronic
1019145231 6:169971644-169971666 AGCCAAGGAGCCGGGGTCTAGGG - Intergenic
1019298865 7:293092-293114 ATCCTAGGAGATGGGTGCTGCGG + Intergenic
1019331530 7:462972-462994 CGCCAAGGAGGTGGGGGCTCCGG - Intergenic
1019984449 7:4645074-4645096 AGCCCAGGAGTTGGAGGCTGTGG + Intergenic
1020004992 7:4778145-4778167 AGCCAAGGAGGTTGAGGCTGCGG + Intronic
1020116567 7:5479647-5479669 AGACTAGGAGACGGGGCCTAGGG + Intronic
1020136273 7:5589890-5589912 AGACCAGGATTTGGGGCCTGGGG - Intergenic
1020181257 7:5924300-5924322 ATCCTAGGAGTTGGGGGCTGTGG - Intronic
1020301676 7:6800589-6800611 ATCCTAGGAGTTGGGGGCTGTGG + Intronic
1020747142 7:12092122-12092144 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1020760454 7:12262206-12262228 AGCCTGGGACATAGGGCCTGAGG + Intergenic
1021459696 7:20872254-20872276 AGCCTGGGAGATGGAGGCTGTGG + Intergenic
1021726695 7:23554199-23554221 AGCCCAGGAGATGGAGGTTGCGG - Intergenic
1023157350 7:37264392-37264414 AGGCAAGTAGATGTGACCTGTGG + Intronic
1023825554 7:44006519-44006541 AGCCCAGGATATGGAGGCTGCGG - Intronic
1023917646 7:44602095-44602117 AGCCTAGGAGATCAAGCCTGCGG + Intergenic
1024232470 7:47373079-47373101 AGGGAAGGAGAAGGGGCCTCTGG + Intronic
1025253143 7:57365424-57365446 AGCCCGGCAGATGTGGCCTGAGG - Intergenic
1025900049 7:65736735-65736757 AGCCAAGTAGCTGGGACTTGAGG - Intergenic
1026089103 7:67285291-67285313 AGCCCAGGATATGGAGGCTGTGG - Intergenic
1026146547 7:67751569-67751591 AGCCAGGGAGCTCGGGACTGTGG - Intergenic
1026492825 7:70877732-70877754 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
1026725147 7:72865059-72865081 AGCCCAGGATATGGAGGCTGCGG + Intergenic
1026747281 7:73023255-73023277 AGCCCAGGATATGGAGGCTGCGG + Intergenic
1026750931 7:73051398-73051420 AGCCCAGGATATGGAGGCTGCGG + Intergenic
1026754580 7:73079508-73079530 AGCCCAGGATATGGAGGCTGCGG + Intergenic
1026758232 7:73107541-73107563 AGCCCAGGATATGGAGGCTGCGG + Intergenic
1026775013 7:73225983-73226005 AGTCAAGGAGGTGGGGACAGCGG - Intergenic
1027033384 7:74907842-74907864 AGCCCAGGATATGGAGGCTGCGG + Intergenic
1027089173 7:75285943-75285965 AGCCCAGGATATGGAGGCTGCGG - Intergenic
1027092816 7:75313871-75313893 AGCCCAGGATATGGAGGCTGCGG - Intergenic
1027096459 7:75341838-75341860 AGCCCAGGATATGGAGGCTGCGG - Intergenic
1027132482 7:75600836-75600858 AGCCCAGGAGTTGGAGGCTGTGG - Intronic
1027273104 7:76534850-76534872 AGCCCAGGATATGGAGGCTGCGG + Intergenic
1027755273 7:82204015-82204037 AGATAAGGCCATGGGGCCTGAGG + Intronic
1028921007 7:96310015-96310037 AGCCAAGGAGAGAAGGCCTCAGG + Intronic
1029147928 7:98459670-98459692 AGCCAAGGATCTGGGCCATGGGG + Intergenic
1029238551 7:99143248-99143270 AGGCAAGGGGGCGGGGCCTGGGG + Intronic
1029397567 7:100318796-100318818 AGCCCAGGATATGGAGGCTGCGG - Intronic
1029718795 7:102349403-102349425 AGCCCAGGATATGGAGGCTGCGG + Intergenic
1029736139 7:102466986-102467008 AGGCCAGGAGTTGGAGCCTGGGG - Intronic
1029753820 7:102559854-102559876 AGCCCAGGATATGGAGGCTGCGG - Intronic
1029771769 7:102658941-102658963 AGCCCAGGATATGGAGGCTGCGG - Intronic
1030915904 7:115313142-115313164 AGCCTAGGAGTTGGAGGCTGTGG - Intergenic
1031985804 7:128164055-128164077 AGCCCAGGTGACTGGGCCTGTGG + Intergenic
1032148686 7:129408254-129408276 AGGCAATGAGATTGGGCCAGGGG + Intronic
1033590989 7:142808381-142808403 AGCCATGCAGCTGGGGCCAGAGG - Intergenic
1033648003 7:143319869-143319891 TGTCAAGGTGATGGGGACTGAGG + Exonic
1034118001 7:148601421-148601443 AGCCCAGGAGGTGGAGGCTGCGG - Intronic
1034485104 7:151355593-151355615 AGCCCAGGAGATGAAGGCTGTGG + Intronic
1034553684 7:151836701-151836723 AGCCCAGGAGCTGTGGCCTGAGG - Intronic
1034828363 7:154287639-154287661 AGCCAAGCAGATGGCCGCTGTGG - Intronic
1034969242 7:155408911-155408933 AGGCAAGGAGACGGTGGCTGGGG - Intergenic
1035020389 7:155797200-155797222 AGCCTTGGAGTTGGGGCCCGGGG - Intergenic
1035020428 7:155797277-155797299 AGCCGTGGACTTGGGGCCTGGGG - Intergenic
1035020462 7:155797362-155797384 AGCCGTGGACTTGGGGCCTGGGG - Intergenic
1035375508 7:158404665-158404687 GGCCAAGGAGCTGGGGGCCGGGG - Intronic
1035375586 7:158404857-158404879 GGCCAGGGAGCTGGGGGCTGGGG - Intronic
1035561456 8:607364-607386 AGAAGAGGAGATGGGGACTGAGG + Intergenic
1035681724 8:1493413-1493435 AGCCAGGGAGATGGAGGCAGCGG - Intergenic
1036037222 8:5032359-5032381 AGCTAAGGTGCAGGGGCCTGTGG + Intergenic
1036125310 8:6056883-6056905 AGCCCAGGAGATGGAGGTTGTGG - Intergenic
1036680592 8:10870047-10870069 AGCCAAGGAGCTGGTTACTGTGG - Intergenic
1037291256 8:17351424-17351446 GGCCAAGGAGAGTGGGCCTCTGG - Intronic
1037356537 8:18026084-18026106 AACCCAGGAGGTGGGGCTTGCGG + Intronic
1037358742 8:18051336-18051358 AGCCTGGGAGATGGAGGCTGCGG - Intergenic
1037410403 8:18589731-18589753 AGCCAAGGAGATGGGCGAGGAGG + Intronic
1037558615 8:20052470-20052492 AGCCCAGGAGATAGAGGCTGTGG - Intergenic
1037986353 8:23292960-23292982 AGCCAAGGCCATGGTGTCTGAGG - Intronic
1038337242 8:26655416-26655438 AGCCCAGGAGATTGAGGCTGTGG + Intronic
1038410999 8:27359919-27359941 GGCCCAGGAGCTGGGGCCGGGGG - Intronic
1038766035 8:30428376-30428398 AGCCAAGGAGTTGGAGGCTGTGG + Intronic
1039442295 8:37603403-37603425 AGCCAAGTGGATGGTGCCTGGGG + Intergenic
1039613200 8:38935494-38935516 AGCCCAGGAGATAGAGGCTGCGG - Intronic
1041080650 8:54211915-54211937 AGAGAAGGAGCTTGGGCCTGAGG + Intergenic
1042611436 8:70606268-70606290 AGCCCAGGAGGTGGAGGCTGCGG - Intronic
1043183352 8:77113350-77113372 AGTGAAGGAGATGAGGACTGAGG - Intergenic
1045586230 8:103540154-103540176 ACCCATGGAGCTGAGGCCTGAGG - Intronic
1046198336 8:110891378-110891400 AGATAAGGTCATGGGGCCTGAGG - Intergenic
1047101110 8:121676684-121676706 AGCCCAGGAGGTGGAGGCTGCGG - Intergenic
1047454018 8:124992505-124992527 AGCCAAGGAGAAGGGGAGTGAGG - Intergenic
1048107905 8:131431567-131431589 ACCTAAGGGGATAGGGCCTGAGG - Intergenic
1048372573 8:133792393-133792415 AGCCAGAGAGCTGGGGCTTGAGG + Intergenic
1048853951 8:138670416-138670438 AGGCCGGGAGCTGGGGCCTGGGG + Intronic
1048993014 8:139772377-139772399 AGATGAGGAGATGGGGGCTGGGG + Intronic
1049436012 8:142586582-142586604 AGCCTAGGAGCTCGGGGCTGGGG - Intergenic
1049746838 8:144266603-144266625 GGCGAAGGACATGGGGCCGGCGG - Exonic
1050186387 9:2979539-2979561 AGACAAGGATGTGGGGCCAGTGG - Intergenic
1052569347 9:30200229-30200251 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1052971643 9:34380545-34380567 GGCCAAGGAGATGGGGGAAGAGG + Intronic
1053164962 9:35837791-35837813 AGGCAAGGAGATGGAGGCCGGGG - Intronic
1054453058 9:65413478-65413500 AGCCTGGGGGATGGGCCCTGTGG - Intergenic
1054734287 9:68734845-68734867 AGCCAAACAGATGGAGGCTGAGG + Intronic
1055336475 9:75237503-75237525 AGATAAGGCCATGGGGCCTGAGG - Intergenic
1056052052 9:82779154-82779176 AGCCTAGGAGATGGAGGTTGCGG + Intergenic
1056312237 9:85352401-85352423 AGTGTTGGAGATGGGGCCTGAGG - Intergenic
1056320733 9:85432457-85432479 AGGCAAGGAGGTGGGGACGGTGG + Intergenic
1057804552 9:98210982-98211004 GGGAAAGGAGATGGGCCCTGAGG + Intronic
1057875340 9:98749310-98749332 AGGGAGGGAGCTGGGGCCTGAGG - Intronic
1058651241 9:107177190-107177212 AGACCAGGTGATGGGGGCTGGGG + Intergenic
1059170512 9:112120227-112120249 AGCCCAGGAGTTGGAGGCTGTGG + Intronic
1060224405 9:121782522-121782544 ACCCAAGGAGAGGGGGACTATGG + Intronic
1060750106 9:126163227-126163249 GGCCAAGGAGATGGGCTCTAGGG + Intergenic
1061329736 9:129885087-129885109 AGCCTAGATGAGGGGGCCTGTGG + Intergenic
1061436488 9:130566135-130566157 AGCCCAGGAGATGGAGACTAGGG - Intergenic
1061505707 9:131030795-131030817 GGACAAGGAGCTGAGGCCTGGGG - Intronic
1061692414 9:132344289-132344311 AGCCCAGGAGGTTGAGCCTGAGG - Intronic
1061783989 9:133013693-133013715 AGCCCAGGAGGTGGAGGCTGAGG + Intergenic
1061805138 9:133133539-133133561 AGCCGAGGCGCTGGGGCCTGGGG + Intronic
1061892468 9:133630038-133630060 GGCCCAGGAGATGGGGGTTGTGG - Intergenic
1061962589 9:133995637-133995659 GTCCAAGGAGAGGGGGCCTGGGG - Intergenic
1061963926 9:134002866-134002888 AGGCCAGGAGATGGTCCCTGAGG - Intergenic
1062369783 9:136231936-136231958 AGCCTGGCAGATGGGACCTGCGG - Intronic
1062443824 9:136585108-136585130 GGACAGGGAGATGGGGCCAGTGG + Intergenic
1062488098 9:136791175-136791197 GGCCTAGGAGACGGCGCCTGAGG - Intergenic
1062613797 9:137387096-137387118 AGACAAGGAGTAGGGGCCGGGGG - Intronic
1062657339 9:137611075-137611097 AAGCAAGGAGAGGAGGCCTGGGG - Intronic
1185433752 X:25185-25207 AGCCTAGGAGCGGGGGGCTGTGG + Intergenic
1185442958 X:237253-237275 AGCCTAGGAGCGGGGGGCTGTGG + Intergenic
1185465548 X:352393-352415 AGCCACGGGGAGGAGGCCTGGGG - Intronic
1185478557 X:429492-429514 AGCCCAGGAGGTGGAGGCTGCGG - Intergenic
1185765352 X:2721371-2721393 AGCCCAGGAGTTGGAGGCTGTGG - Intronic
1185965328 X:4593949-4593971 AGCCCAGGAGTTGGAGGCTGAGG - Intergenic
1185984050 X:4810740-4810762 AGCCCAGGAGGTGGAGGCTGTGG + Intergenic
1186085665 X:5987997-5988019 AGCCCAGGAGTTGGAGGCTGCGG + Intronic
1186115012 X:6296503-6296525 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
1186454094 X:9697691-9697713 AGCCCAGGAGATGGAGTTTGCGG + Intronic
1187460768 X:19484961-19484983 GTCGAAGGAGATTGGGCCTGAGG - Intronic
1188236818 X:27741417-27741439 AGCCATGGTGCTGGGGCATGGGG - Intronic
1189463455 X:41260745-41260767 GGCCAAGAAGATGGGGCATGGGG - Intergenic
1189829141 X:44952852-44952874 AGCCCAGGAGGTGGTGGCTGCGG - Intronic
1190256937 X:48770527-48770549 AGGCAATGAGATGGGGGCAGAGG - Intronic
1190335073 X:49257366-49257388 AGCCAAGGATCTGGGGACTTGGG + Intronic
1192464799 X:71346836-71346858 AGCCCAGGAGGTGGAGGCTGGGG + Intergenic
1195197898 X:102516934-102516956 GGCCTGGGAGGTGGGGCCTGGGG - Intergenic
1195347145 X:103962451-103962473 GGCCTGGGAGGTGGGGCCTGGGG + Intronic
1195360297 X:104076390-104076412 GGCCTGGGAGGTGGGGCCTGGGG - Intergenic
1195375233 X:104220342-104220364 AGCCAGGGAGATGCAGCCTTTGG + Intergenic
1196882122 X:120208008-120208030 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1197178468 X:123509486-123509508 AGCCCAGCAGCTGGGGCCTTTGG + Intergenic
1198082059 X:133249447-133249469 AGCCAAGGGGGTGGGGGTTGGGG - Intergenic
1198405350 X:136306649-136306671 AGGAAAGGGGATGGGGCATGAGG - Intronic
1198894498 X:141437943-141437965 AGCCCAGGAGGTGGAGGCTGCGG - Intergenic
1199552852 X:149077087-149077109 AGATAAGGCCATGGGGCCTGAGG + Intergenic
1199769655 X:150966446-150966468 AGCAAAGGTGAAAGGGCCTGAGG - Intergenic
1199802195 X:151262528-151262550 AGCCCAGGAGCTGAGGCTTGAGG - Intergenic
1199977225 X:152901328-152901350 AGCCCAGGAGTTGGAGGCTGCGG - Intergenic
1200080848 X:153575632-153575654 AGCCACGGGGCTGGGGCCGGGGG + Intronic
1200110720 X:153739571-153739593 AGCCCAGGAGTTGGAGACTGCGG + Intronic