ID: 915163112

View in Genome Browser
Species Human (GRCh38)
Location 1:153933436-153933458
Sequence TGCCTTAGCATTAGTGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915163112_915163116 -3 Left 915163112 1:153933436-153933458 CCAAGCCCACTAATGCTAAGGCA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 915163116 1:153933456-153933478 GCATCTGGACCCTCCTTCACTGG 0: 1
1: 0
2: 0
3: 11
4: 119
915163112_915163120 9 Left 915163112 1:153933436-153933458 CCAAGCCCACTAATGCTAAGGCA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 915163120 1:153933468-153933490 TCCTTCACTGGCTACCTCGGAGG 0: 1
1: 0
2: 0
3: 8
4: 90
915163112_915163118 6 Left 915163112 1:153933436-153933458 CCAAGCCCACTAATGCTAAGGCA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 915163118 1:153933465-153933487 CCCTCCTTCACTGGCTACCTCGG 0: 1
1: 0
2: 2
3: 16
4: 237
915163112_915163122 15 Left 915163112 1:153933436-153933458 CCAAGCCCACTAATGCTAAGGCA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 915163122 1:153933474-153933496 ACTGGCTACCTCGGAGGCAGTGG 0: 1
1: 0
2: 2
3: 103
4: 1641
915163112_915163125 23 Left 915163112 1:153933436-153933458 CCAAGCCCACTAATGCTAAGGCA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 915163125 1:153933482-153933504 CCTCGGAGGCAGTGGATCCAGGG 0: 1
1: 0
2: 1
3: 15
4: 434
915163112_915163123 22 Left 915163112 1:153933436-153933458 CCAAGCCCACTAATGCTAAGGCA 0: 1
1: 0
2: 0
3: 14
4: 128
Right 915163123 1:153933481-153933503 ACCTCGGAGGCAGTGGATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915163112 Original CRISPR TGCCTTAGCATTAGTGGGCT TGG (reversed) Intronic
901261791 1:7876515-7876537 AGCATTGGCAGTAGTGGGCTAGG - Intergenic
906021186 1:42631181-42631203 AACCATAGCATTACTGGGCTTGG - Intronic
909309481 1:74128828-74128850 AGCCACAGCATTACTGGGCTTGG - Intronic
912015458 1:105028253-105028275 AGCAATAGCATTAATGGGCTTGG + Intergenic
912941421 1:114048508-114048530 TGTGTTAACATTACTGGGCTGGG - Intergenic
914317609 1:146529117-146529139 TGAGTTAGCATTGGTGGACTAGG - Intergenic
914496747 1:148204243-148204265 TGAGTTAGCATTGGTGGACTAGG + Intergenic
914826275 1:151139820-151139842 TGCCTTGGCATTTGTGCTCTGGG + Intronic
915163112 1:153933436-153933458 TGCCTTAGCATTAGTGGGCTTGG - Intronic
916360692 1:163963701-163963723 AGCCATAGCATTACTGGGCCTGG + Intergenic
917123415 1:171664452-171664474 AACATTAGCATGAGTGGGCTCGG + Intergenic
924490684 1:244534998-244535020 AGTCATAGCATTACTGGGCTTGG - Intronic
1062878919 10:962843-962865 TGCCGTAGCCTCAGTGAGCTCGG + Intergenic
1064936360 10:20683124-20683146 TGCTTTTGCATTAGTCTGCTGGG - Intergenic
1071018196 10:81022163-81022185 AGCCATAGCATTGCTGGGCTTGG + Intergenic
1073882686 10:108001802-108001824 TCCCTTTGCATTAGTGTTCTAGG + Intergenic
1078025627 11:7692606-7692628 AGCATTTGCATAAGTGGGCTCGG + Intronic
1078506849 11:11957939-11957961 TGAGTTTGCATTAGTGGGATTGG + Intronic
1079484134 11:20916416-20916438 TGCTTTAGGATTAGCGGGATGGG + Intronic
1079564729 11:21867387-21867409 TGCTATAGCATTTGAGGGCTTGG + Intergenic
1080274800 11:30491715-30491737 TGCATTAGCATTTCTGTGCTAGG - Intronic
1080351262 11:31387525-31387547 AGCCACAGCATTACTGGGCTTGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1093617332 12:21241943-21241965 AACCTCAGCATTACTGGGCTTGG + Intergenic
1098060453 12:66555327-66555349 AGCCATAGCATTACTGGGCTTGG + Intronic
1110078818 13:71285901-71285923 AGCCAGAGCATTACTGGGCTTGG - Intergenic
1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG + Intergenic
1111598147 13:90436525-90436547 TGGCTTAGTATTAGTGAGTTTGG + Intergenic
1115861322 14:37688735-37688757 TACCACAGCATTACTGGGCTTGG + Intronic
1116434194 14:44878014-44878036 AACCATAGCATTATTGGGCTTGG + Intergenic
1117634438 14:57726824-57726846 AGCATTTGAATTAGTGGGCTGGG + Intronic
1117795292 14:59387721-59387743 AGCCACAGCATTATTGGGCTTGG - Intergenic
1117842890 14:59879916-59879938 AGCCATAGCATTACTGGGCTTGG - Intergenic
1119096725 14:71839962-71839984 AGCCACAGCATTACTGGGCTTGG - Intergenic
1120739835 14:88095892-88095914 TGCCTGTGTATTATTGGGCTGGG + Intergenic
1127132787 15:55884207-55884229 AGCCACAGCATTACTGGGCTTGG + Intronic
1127720316 15:61692763-61692785 TCCCTTAGGTTCAGTGGGCTTGG - Intergenic
1136481685 16:30545989-30546011 TGCCTTTGCACCAGTAGGCTGGG + Intronic
1140566979 16:76055340-76055362 AGCCATAGCGTTACTGGGCTTGG - Intergenic
1140847305 16:78902808-78902830 AGGCTTAGCCTTAGTGGGCCTGG + Intronic
1141594950 16:85091682-85091704 CTCCTCAGCATTACTGGGCTGGG - Exonic
1142688875 17:1592946-1592968 TGCCTTTGCATTTCGGGGCTGGG - Intronic
1151767374 17:76139369-76139391 TGCCTTAGCATGTGAGGGCCAGG - Intronic
1152580196 17:81162402-81162424 TGCCTGAGCCTGAGTGGTCTGGG + Intronic
1153594887 18:6715484-6715506 TGCTTTAGCTTTGGTGGGGTTGG + Intergenic
1155918780 18:31581820-31581842 TGCTTTAGCATTTGTGAGCTTGG - Intergenic
1165479134 19:36051659-36051681 GGTCTTAGCCTAAGTGGGCTAGG - Intronic
1166918234 19:46210741-46210763 AACTTTTGCATTAGTGGGCTGGG - Intergenic
1167404355 19:49294646-49294668 TGGCTTAGCATTACTGATCTGGG + Intronic
925698815 2:6612775-6612797 AGTCATAGCATTACTGGGCTTGG - Intergenic
928130194 2:28643425-28643447 TGCCTTTGAAATAGTGGGTTTGG - Exonic
930041283 2:47126721-47126743 TGCCTTAGCTTTGGTTGTCTGGG + Intronic
939604645 2:144238834-144238856 AGCCTTAGCAATAGTGGTTTTGG - Intronic
940468787 2:154065641-154065663 AGCCATAGCATTACTGGGTTTGG + Intronic
940477160 2:154177651-154177673 TGCAGTAGGAATAGTGGGCTAGG + Intronic
942617116 2:177804068-177804090 TGCCTTTGCTTTTGAGGGCTTGG - Intronic
943057868 2:183005861-183005883 TGCTTTAGGAATAGTGGGGTTGG - Intronic
944760507 2:202808798-202808820 AGCCACAGCATTACTGGGCTTGG + Intronic
946947588 2:224837586-224837608 TCTCTTTGCATTAATGGGCTAGG - Intronic
948614215 2:239188003-239188025 TGCCTTGGCATTTGTTGGCTTGG - Intronic
1169302069 20:4451728-4451750 TGGCTCAGCTTCAGTGGGCTTGG - Intergenic
1183497350 22:38154529-38154551 AGCCATAGTATTAGTAGGCTTGG + Intronic
949111357 3:265041-265063 TGCCTTAGCAGTAGTAGTGTGGG - Intronic
949259451 3:2088206-2088228 TGCATAAGCATTAATTGGCTGGG - Intergenic
951819228 3:26790357-26790379 TACCACAGCATTACTGGGCTTGG - Intergenic
952811757 3:37410772-37410794 AGCCACAGCATTACTGGGCTTGG - Intronic
960153416 3:114274224-114274246 AGCCACAGCATTACTGGGCTTGG - Intergenic
962465653 3:135655499-135655521 AGCCATAGCATTGCTGGGCTTGG + Intergenic
963112871 3:141701259-141701281 TGCCTTTGCACCAGTAGGCTGGG + Intergenic
963330656 3:143910919-143910941 AGCCACAGCATTATTGGGCTTGG + Intergenic
964582775 3:158259298-158259320 AGCCACAGCATTACTGGGCTTGG - Intronic
965118200 3:164519327-164519349 AACCTCAGCATTACTGGGCTTGG - Intergenic
965866906 3:173216016-173216038 AGCCATAGCATTACTGGGCTTGG - Intergenic
966479392 3:180389074-180389096 TGCCTTACAATTAGTAGGCCGGG + Intergenic
970915411 4:21328285-21328307 AGCCATAGCATTACTGGACTTGG - Intronic
972207903 4:36799594-36799616 AACCATAGCATTAGTGGGCTTGG + Intergenic
972278311 4:37580493-37580515 AACCATAGCATTACTGGGCTTGG - Intronic
973287784 4:48439446-48439468 AGCCATAGCATTACTGGGCTTGG - Intergenic
974415731 4:61604081-61604103 TGTCTTATCATCAGTGGTCTGGG + Intronic
975629896 4:76388932-76388954 AACCATAGCATTATTGGGCTTGG + Intronic
977680152 4:99789864-99789886 AGCCACAGCATTACTGGGCTTGG - Intergenic
978880361 4:113695181-113695203 TGCCTTGGAATTTGTGGGATGGG + Intronic
979564949 4:122144893-122144915 AGTCATAGCATTAATGGGCTTGG - Intergenic
980582572 4:134773455-134773477 TCCCTGAGCATTTGGGGGCTGGG + Intergenic
982261054 4:153494808-153494830 GGCCTCAGCACCAGTGGGCTTGG + Intronic
982680554 4:158423807-158423829 TTCCTGATCATTAGTGAGCTTGG + Intronic
984592346 4:181630989-181631011 TTCCTGAGCATAAGTGAGCTGGG + Intergenic
986458737 5:7946638-7946660 TGCCTTAGTATGCATGGGCTTGG + Intergenic
986885104 5:12225267-12225289 AGCCATAGCATTACTGGTCTTGG - Intergenic
989970625 5:50520624-50520646 AGCCACAGCATTAATGGGCTTGG - Intergenic
994217723 5:97158351-97158373 AGCCATAGCATTACTGGGCTTGG - Intronic
994274593 5:97821354-97821376 TGCCACAGTATTATTGGGCTTGG - Intergenic
995417623 5:111927496-111927518 TCCCTTAGGAATAGTGGGTTTGG - Intronic
998439833 5:142149094-142149116 AGCCCTAGCATTAATGAGCTAGG + Intronic
1005855652 6:29860981-29861003 TGGCTTAGATTTACTGGGCTGGG + Intergenic
1006039162 6:31239474-31239496 TGCCTTAGATTTACTGGGATGGG - Intergenic
1006893460 6:37449723-37449745 TCCCTTAGAATGAATGGGCTAGG + Intronic
1008731653 6:54490737-54490759 AACCATAGCATTATTGGGCTTGG - Intergenic
1010182046 6:73097790-73097812 AACCATAGCATTACTGGGCTTGG + Intronic
1012379311 6:98601026-98601048 TGCTTTAGCATTTTTGGTCTTGG - Intergenic
1017206430 6:151808225-151808247 TGCAGTAGCATCAGCGGGCTCGG - Exonic
1022210955 7:28208931-28208953 GGCCTCTGAATTAGTGGGCTAGG + Intergenic
1023445492 7:40227378-40227400 TGAATTATCATTATTGGGCTGGG - Intronic
1026467721 7:70668841-70668863 TGCCTCAGCGCTAGAGGGCTTGG + Intronic
1027605016 7:80288906-80288928 GGCCACAGCATTACTGGGCTTGG + Intergenic
1028207414 7:88033262-88033284 AGCCATAGCATTACTGGGCTTGG - Intronic
1029819282 7:103130324-103130346 TGCTTTAGCTTTAGTCAGCTGGG - Intronic
1030990447 7:116292459-116292481 AGCCACAGCATTACTGGGCTTGG + Intronic
1031187214 7:118498031-118498053 TGCCTTAGCCTTAGTGAGTGTGG - Intergenic
1031412043 7:121450886-121450908 TGGCTTAGCAGTATTGGCCTTGG - Intergenic
1034126542 7:148676472-148676494 AGCCTCAGCATTATTGGGCTTGG + Intergenic
1036696221 8:10976869-10976891 TGCCTGAGCCCCAGTGGGCTGGG + Intronic
1038356494 8:26833655-26833677 TGCCTTAGCAATATGGTGCTAGG - Intronic
1038997796 8:32945276-32945298 AGCAGTGGCATTAGTGGGCTGGG + Intergenic
1042162762 8:65913290-65913312 AACCATAGCATTACTGGGCTTGG + Intergenic
1044814363 8:96096002-96096024 TACATTAGCATTAGTATGCTTGG - Intergenic
1048703573 8:137123255-137123277 TGCCTTTGCAATCGTGGGATCGG - Intergenic
1048747171 8:137626838-137626860 TGGCTTGGAATTAGTGGGTTGGG + Intergenic
1050230344 9:3517546-3517568 TGCCTTTGCTTTAGAGTGCTTGG - Intronic
1050238714 9:3612199-3612221 AGCCACAGCATTACTGGGCTTGG - Intergenic
1050439119 9:5642105-5642127 AACCTCAGCATTATTGGGCTTGG - Intronic
1055211887 9:73805263-73805285 TGCTGTTGCATTAGTGGCCTTGG + Intergenic
1055836570 9:80449664-80449686 TCCCTTAGCATTCCAGGGCTAGG - Intergenic
1056100204 9:83293669-83293691 TGCCTTGGCATTAGATGGCCAGG + Intronic
1057636484 9:96774009-96774031 AGCCTTAGTATTAGTTTGCTAGG - Intronic
1057747871 9:97766263-97766285 TGCCTTGGCATTCCTGGGCTGGG - Intergenic
1059041906 9:110823543-110823565 AGCCACAGCATTACTGGGCTTGG + Intergenic
1059978805 9:119746613-119746635 TGCTTTAGAATTAGAAGGCTTGG + Intergenic
1060304626 9:122399328-122399350 AGCCACAGCATTACTGGGCTTGG + Intergenic
1186111601 X:6263280-6263302 TGCCTTATCATGGGTGGGCTTGG - Intergenic
1187127970 X:16471487-16471509 TCCCTTAACATCAGTGTGCTGGG - Intergenic
1187618228 X:21021312-21021334 AGCCACAGCATTACTGGGCTTGG + Intergenic
1187836334 X:23435767-23435789 AGCCATAGCATTACTGGGCTTGG + Intergenic
1188037450 X:25334594-25334616 TGACTTAGCTTTATTGGGTTTGG + Intergenic
1189274643 X:39776929-39776951 TGCCTGAGATTTATTGGGCTGGG + Intergenic
1189858329 X:45246964-45246986 AGCCACAGCATTACTGGGCTTGG - Intergenic
1192304291 X:69943393-69943415 AGCCACAGCATTATTGGGCTTGG - Intronic
1192393527 X:70754904-70754926 AACCAGAGCATTAGTGGGCTTGG + Intronic
1193246045 X:79231632-79231654 GGCCACAGCATTACTGGGCTTGG - Intergenic
1193765711 X:85527340-85527362 AGCCACAGCATTACTGGGCTTGG - Intergenic
1194692787 X:97008646-97008668 AGCCACAGCATTAGTGGGCTTGG - Intronic
1197391788 X:125877101-125877123 AACCATAGCATTACTGGGCTTGG - Intergenic
1199457269 X:148043462-148043484 AGCCACAGCATTACTGGGCTTGG - Intergenic