ID: 915163185

View in Genome Browser
Species Human (GRCh38)
Location 1:153933694-153933716
Sequence CTGGAAGGGCTAAGTGGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915163185_915163195 -7 Left 915163185 1:153933694-153933716 CCCCGCCCACTTAGCCCTTCCAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 915163195 1:153933710-153933732 CTTCCAGGGCCTCAGTGGACTGG 0: 1
1: 0
2: 6
3: 18
4: 300
915163185_915163199 2 Left 915163185 1:153933694-153933716 CCCCGCCCACTTAGCCCTTCCAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 915163199 1:153933719-153933741 CCTCAGTGGACTGGGCACTCAGG 0: 1
1: 0
2: 0
3: 14
4: 194
915163185_915163200 3 Left 915163185 1:153933694-153933716 CCCCGCCCACTTAGCCCTTCCAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 915163200 1:153933720-153933742 CTCAGTGGACTGGGCACTCAGGG 0: 1
1: 0
2: 0
3: 20
4: 161
915163185_915163196 -6 Left 915163185 1:153933694-153933716 CCCCGCCCACTTAGCCCTTCCAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 915163196 1:153933711-153933733 TTCCAGGGCCTCAGTGGACTGGG 0: 1
1: 0
2: 1
3: 19
4: 237
915163185_915163201 22 Left 915163185 1:153933694-153933716 CCCCGCCCACTTAGCCCTTCCAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 915163201 1:153933739-153933761 AGGGCTGAGCCTGAGCCCCCTGG 0: 1
1: 0
2: 2
3: 45
4: 438
915163185_915163202 23 Left 915163185 1:153933694-153933716 CCCCGCCCACTTAGCCCTTCCAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 915163202 1:153933740-153933762 GGGCTGAGCCTGAGCCCCCTGGG 0: 1
1: 0
2: 2
3: 39
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915163185 Original CRISPR CTGGAAGGGCTAAGTGGGCG GGG (reversed) Exonic
900402510 1:2478310-2478332 CTGGCAGGGCGGTGTGGGCGGGG + Intronic
900626342 1:3610412-3610434 CTGGCAGGGGTGGGTGGGCGAGG - Intronic
903048597 1:20584000-20584022 CTGGGATGGCTAAGGGGGTGTGG + Intergenic
903478185 1:23634796-23634818 CTGGAGGGGCAGAGTGGGCGAGG + Intronic
903662061 1:24984346-24984368 CTGGAAGGGCTAAGGGGGTGTGG + Intergenic
906210408 1:44009711-44009733 TTGGTAGGGGTAAGTTGGCGGGG + Intronic
906240363 1:44238852-44238874 CTGACAGGGCTAAGTGAGCAGGG - Intronic
907983263 1:59505684-59505706 CAGGAAGGGGTAAGTGGGGGCGG - Intronic
912469727 1:109898217-109898239 CTGGAAGGGGTGAGTGAGCCTGG - Intergenic
912586920 1:110775496-110775518 TTGGAAGGGCTATGTGATCGAGG - Intergenic
914796712 1:150926184-150926206 CTGGCAGGGCAGAGTAGGCGTGG - Intergenic
915163185 1:153933694-153933716 CTGGAAGGGCTAAGTGGGCGGGG - Exonic
917591436 1:176480547-176480569 CTGGAAGGGCCAGGTGGGGAAGG + Intronic
921980507 1:221252211-221252233 CTGGAAGGGCCAGGTGGGCCAGG + Intergenic
922373004 1:224929915-224929937 CTGGGAGGGCTGCGTGGGCGCGG + Intronic
922905191 1:229168776-229168798 ATGGAAGGGCTCAGTGAGTGTGG - Intergenic
923820644 1:237436490-237436512 CTGGAAGGGCTAACTAAGCCTGG + Intronic
1063986173 10:11505206-11505228 CAGGAAGGGAAAAGTGGGGGTGG + Intronic
1065993240 10:31032453-31032475 GGGCAAGGCCTAAGTGGGCGTGG - Intergenic
1068386514 10:56335532-56335554 CTGGAAGGGCTAAGTGTTGAAGG - Intergenic
1069922521 10:71825223-71825245 TTGGCAGGGCTGAGTGGGTGGGG - Intronic
1073094297 10:100970295-100970317 GGGGCGGGGCTAAGTGGGCGGGG - Intronic
1077171398 11:1167810-1167832 CTGGCAGGGCCAGGTGGGCTGGG + Intronic
1083396346 11:62395290-62395312 CTGGAAGGAGCAAGTGGGGGCGG - Intergenic
1083420330 11:62548878-62548900 CAAAAAGGGCTAAGGGGGCGTGG + Intronic
1084123222 11:67081755-67081777 CGGGCAGGGCTCAGTGGGTGGGG - Intergenic
1086518289 11:87640141-87640163 CTGGGAGGGCTGAGTCGGTGAGG + Intergenic
1088152173 11:106758268-106758290 CTTGCTGGGCTATGTGGGCGTGG + Intronic
1088292253 11:108252462-108252484 GTGGAAAGGTTAAGTGGACGAGG - Intronic
1088740711 11:112764851-112764873 CTGGAGAGGCTAAGTGAGCTGGG - Intergenic
1092921250 12:13233473-13233495 CAGTAAGGGCTGAGTGGGCTGGG - Intergenic
1093220145 12:16411016-16411038 GAGGAAGAGCTAAGTGGGAGTGG - Intronic
1094058849 12:26292343-26292365 ATAGAAAGGCTAAGTGGGCCAGG + Intronic
1095230509 12:39733829-39733851 CTTGAAGGGCTCTGTGGGGGTGG + Intronic
1095310786 12:40693764-40693786 CTGGAAGCACTGAGTGGGCGGGG + Intronic
1096156248 12:49342940-49342962 CCGGGAGGGCTAAGCGGCCGGGG - Intergenic
1097130384 12:56806902-56806924 CTGGAAAGGCTAAGAGGGAGGGG - Intergenic
1098938411 12:76506745-76506767 CTGGAAGGGGAAAGTGGCTGGGG + Intronic
1102644203 12:114393336-114393358 CTGGAAGGGCAAAGTGGGAGGGG - Intronic
1104169528 12:126266678-126266700 CTGGAAAGGGTGAGTGGGAGGGG + Intergenic
1104808029 12:131601885-131601907 GTGGAAGGGCAATGTGGGCTTGG - Intergenic
1104830624 12:131748491-131748513 CTGGAAGAGCTAAGTCAGGGAGG - Intronic
1105504392 13:20997895-20997917 CAGGAAGGGCTGAGTGGGGGAGG - Intronic
1105872690 13:24520600-24520622 CTGGAAGTGCTAACTGTGCTTGG + Intergenic
1106419405 13:29572919-29572941 TTGGAAGGGATAAGTGGTCCAGG + Intronic
1108359073 13:49652710-49652732 CCAGAAGTGCTAAGTGGGTGTGG + Intergenic
1108503250 13:51086834-51086856 CTGGAGGGGCTGCGTGGGAGAGG + Intergenic
1113767265 13:112889167-112889189 CTGGGAGGGCTCAGGGGACGGGG + Intergenic
1118092064 14:62492961-62492983 TTGGAAGGGAAAAGTGGGAGAGG - Intergenic
1119034534 14:71218439-71218461 CTGGAAGGGCCAGGAGGGGGTGG - Intergenic
1119251229 14:73156522-73156544 CTGGAGTGGCAAAGTGAGCGGGG + Intronic
1121357997 14:93231239-93231261 GGGAGAGGGCTAAGTGGGCGAGG + Intergenic
1122650919 14:103226690-103226712 CAGGTAGGGCTGAGTGGCCGTGG - Intergenic
1127515446 15:59689155-59689177 CTGGAGGGGCGAAGAGGACGAGG - Exonic
1128091747 15:64923790-64923812 TTGGAAGGGCTCAGTGGCCCTGG + Intronic
1129488794 15:75903830-75903852 CTGGACGGGGAAGGTGGGCGTGG - Intergenic
1130060520 15:80566567-80566589 CTGGCAGGGCCAGGTGGGAGGGG - Intronic
1131813817 15:96201773-96201795 CTGGAAGGGCAATGTTGGGGCGG - Intergenic
1132754141 16:1474597-1474619 CCGGGAGGGCTGCGTGGGCGAGG - Intronic
1137222717 16:46471807-46471829 CTGGAGGGGCTCAGTGGTCCAGG + Intergenic
1137493044 16:48949036-48949058 CTGGAAGGGCTAAGTTGGGCTGG + Intergenic
1137592962 16:49704991-49705013 CTGGAAGGGCTAGGCAGGAGTGG - Intronic
1137668854 16:50267537-50267559 CTGGAAGGGCTATGTGACCGTGG + Intronic
1140511737 16:75513519-75513541 CTGGAGGGACTATGTGGGCAAGG - Intergenic
1141331768 16:83117453-83117475 CTGGAAGTGCTCAGGGGGAGAGG - Intronic
1142127328 16:88416761-88416783 CTGGAAGGGCGAAGGGTGCGTGG - Intergenic
1142153903 16:88524572-88524594 CTGGCAGGACAAAGTGGGCATGG - Intronic
1142204018 16:88774102-88774124 CAGGCAGGGCTGGGTGGGCGTGG + Intronic
1142287162 16:89176162-89176184 CTGGTAAGTCTGAGTGGGCGGGG - Intronic
1142644743 17:1304527-1304549 TTGGAAGGGCAGGGTGGGCGTGG + Intergenic
1146905624 17:36616097-36616119 CTTGAAGGTCTAAGTGGGGCAGG - Intergenic
1147135836 17:38433841-38433863 CAGGAAGGGCTTGGTGGCCGAGG + Intronic
1147872421 17:43596970-43596992 CTGGAAGGGATAACTGGTTGGGG + Intergenic
1148582498 17:48753262-48753284 CTGGAAGGGCTGGGTGGCGGGGG + Intergenic
1148894930 17:50834083-50834105 CTTGAAGGGGAAAGTGGACGTGG + Intergenic
1151724051 17:75874618-75874640 CTGGAAGGGGTCAATGGGGGAGG + Exonic
1152293650 17:79454485-79454507 CTGGGAGGGCTTGGTGGGCAAGG - Intronic
1153995375 18:10436095-10436117 CTGGAAGGGCTAGATGGGTCCGG + Intergenic
1155434602 18:25798556-25798578 CTGGAATGGCTAAGAGGATGTGG - Intergenic
1156816453 18:41317119-41317141 CTGGGTGGGCTGAGTGGGCAGGG + Intergenic
1157602109 18:48900201-48900223 CTGGAAAGGCTGAGAGGGAGAGG + Intergenic
1157710868 18:49848839-49848861 CTGGAAGGTCTTAGAGGGCAGGG - Intronic
1159265490 18:66073631-66073653 GTGGAAGGGAAAAGTGGGCTTGG - Intergenic
1159944430 18:74433442-74433464 CTGGAAGGGCTGAGCAGGCTGGG + Intergenic
1160963358 19:1734620-1734642 CTTGAAAGGCTGAGCGGGCGAGG - Intergenic
1162188125 19:8922884-8922906 CTGGTTTGTCTAAGTGGGCGAGG + Intronic
1162310806 19:9906157-9906179 CTGGAAGGGCAAGGTGGCCATGG - Intronic
1162401787 19:10451011-10451033 CTGGATGGGACCAGTGGGCGCGG + Intronic
1163230889 19:16001462-16001484 CTGCAAGGGCTAAGGGAGGGTGG - Intergenic
1163496296 19:17648219-17648241 GTGGAAGGGCTAGGGGGTCGAGG - Intronic
1165952166 19:39480620-39480642 CTGCAAGGCCCAAGGGGGCGTGG + Exonic
1167216543 19:48169692-48169714 CTGGAAGTGCTGAGGGGGCGGGG - Intronic
1167216554 19:48169720-48169742 CCGGAAGTGCTGAGGGGGCGGGG - Intronic
1168554376 19:57325903-57325925 CAGGAAGGGCTAAATGAGGGAGG - Intronic
926245961 2:11122705-11122727 CTGGCAGGGCTAAGTGGTGCAGG - Intergenic
935692124 2:105741481-105741503 ATGGCAGGGCTAAGTTGGAGAGG + Intergenic
939874828 2:147565558-147565580 CTGGGAGGGCTGAGTGTGCAGGG + Intergenic
944685361 2:202113039-202113061 GGGGCAGGGCTAAGTGAGCGGGG - Intronic
944699682 2:202235741-202235763 TTGGGAGGCCTAAGTGGGGGAGG - Intronic
946032391 2:216715609-216715631 CAGCAAGGGCTTTGTGGGCGCGG + Intergenic
947253056 2:228130122-228130144 CTGAAAGGGCTATTTGGGCCTGG - Intronic
947516544 2:230809858-230809880 CCGGGAGCGCTAAGTGGGCGTGG + Intronic
947988094 2:234465884-234465906 TTGGAAGGGCCACGTGAGCGAGG - Intergenic
1170443094 20:16398415-16398437 CAGGAAGGGCTAAGGAGGTGTGG + Intronic
1170931447 20:20772589-20772611 CTGGGAGGGCTAAGTGGGACTGG + Intergenic
1171359161 20:24574556-24574578 CTGGAAGTGCTCAGTGGCCTGGG - Intronic
1172230567 20:33333142-33333164 CTGCCAGGGCCACGTGGGCGAGG - Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173278733 20:41607694-41607716 CTGGATGGGCCAAGAGGGAGGGG + Intronic
1173669290 20:44786547-44786569 CTAGAAGAGCTCAGTGGGTGAGG - Intronic
1175374537 20:58515162-58515184 CTGGAAGGGCAAGCGGGGCGGGG + Intergenic
1175977453 20:62718180-62718202 CTGGAAGAAGTGAGTGGGCGTGG + Intronic
1181471513 22:23143128-23143150 CAGAAAGGGCTAACTGGGCCAGG + Intronic
1181830515 22:25556853-25556875 CTTGAAGGGCTAAAGGGGCAAGG + Intergenic
1182694594 22:32188179-32188201 TTAGAAAGACTAAGTGGGCGAGG - Intergenic
1183300888 22:37058678-37058700 CCAGAAGGGCTCTGTGGGCGTGG + Intronic
1184152952 22:42649161-42649183 CTGGGCGGGCGAAGTGGGTGCGG + Intronic
950631624 3:14285843-14285865 CAGGAAGGGCTAAGAGGGTCTGG - Intergenic
951738196 3:25891279-25891301 TTGGAAGGCCGAGGTGGGCGGGG - Intergenic
954559031 3:51539858-51539880 CTGGAAGGGTTATGTGGGGCTGG + Intergenic
956088907 3:65643170-65643192 ATGGAAGGGAAAAGTGGGTGAGG - Intronic
959917954 3:111839162-111839184 CTGGAAGAGCTCAGTGTGGGTGG - Intronic
961069816 3:123912262-123912284 CTGAAAGGGCTGAGAGGGCTGGG + Intronic
964466596 3:156999566-156999588 GTGGAAGGGCTAAGGGGGACAGG + Intronic
964672156 3:159238574-159238596 CTTGAAGAGCTGAGTGGGGGAGG + Intronic
965726708 3:171724829-171724851 CTGTACGAGCTAAGTGGGAGTGG - Intronic
966592872 3:181700909-181700931 CCGCAATGGCTAATTGGGCGTGG - Intergenic
966863907 3:184245777-184245799 CTGGAAGGCCTACATGGCCGAGG - Exonic
966910701 3:184558333-184558355 CTGGACTGGCTAAGTTGGGGAGG - Intronic
967988172 3:195111476-195111498 CTGGCTGGGCTGAGTGGGCTGGG + Intronic
969300766 4:6295651-6295673 CTGCAAGGGCTCAGGGAGCGAGG + Intronic
972475588 4:39446661-39446683 CGGGGAGGCCTAGGTGGGCGTGG - Exonic
976266560 4:83190763-83190785 CTGGAAGGTCTCAGAAGGCGGGG - Intergenic
985875547 5:2591390-2591412 CTGGAGGGGCAGAGTGGACGTGG + Intergenic
987862750 5:23507494-23507516 CAGGAGGCGCTAAATGGGCGGGG - Intronic
989444380 5:41510424-41510446 CTGGAATGGCTAAATTGGTGAGG + Exonic
989751877 5:44904754-44904776 CAGGCAGGGCTAAGTGGGGATGG + Intergenic
992621080 5:78593717-78593739 CTGGAAGGACCAAGTGTGTGTGG + Intronic
993251561 5:85531322-85531344 CTGGAGAGGCTGAGTGGGGGAGG - Intergenic
994064573 5:95523258-95523280 CTGGAACGGCAAAATGGGCCTGG - Exonic
995073409 5:107951479-107951501 CTGGCAGGGCCTAGTGGGCCTGG + Intronic
996553029 5:124749405-124749427 CAGGAAGGGCAAAGTGGTGGGGG - Intergenic
996760307 5:126980191-126980213 CTGGAAGTGACAAGTGGGCTGGG + Intronic
998146710 5:139733409-139733431 GAGGAAGGGGTAAGTGGGCAAGG - Intergenic
999044626 5:148453671-148453693 CAGCCAGGGCCAAGTGGGCGGGG + Intronic
1002562573 5:180092279-180092301 ATGGAAGGGCTGAGTGGAGGAGG + Intergenic
1002866569 6:1127218-1127240 CTGGATGGGCAAAGTGAGCAAGG - Intergenic
1003103481 6:3195315-3195337 GTTGAAGGACTAAGTGAGCGAGG + Intergenic
1003964150 6:11237107-11237129 CTGAAAGGGCGAGGTGGGCAGGG - Intronic
1004334453 6:14751544-14751566 CTGGAGTGGCTTAGTGGGCAGGG - Intergenic
1006373597 6:33659697-33659719 CTGGTAGGGCCATGTGGGTGGGG - Intronic
1006470428 6:34225729-34225751 TAGGAAGCGCTAAGTGGGGGTGG + Intergenic
1007335164 6:41150485-41150507 CTGGAAGCAGTAAGTGGGTGGGG - Intronic
1007496615 6:42264350-42264372 CTGGAAGGCCCCAGTGGGCCTGG + Intronic
1010154019 6:72770993-72771015 CTAGAAGGGGGAAGGGGGCGGGG + Intronic
1011277450 6:85643783-85643805 CTGGAACGGCTACGCGGCCGCGG - Intronic
1012802779 6:103854203-103854225 CTGGAAGGGATGAGTGGGCCAGG + Intergenic
1015117796 6:129668586-129668608 CTTGAAGGGAGAAGTGGGAGAGG - Intronic
1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG + Exonic
1018962038 6:168456060-168456082 CAGGGAGGGCGGAGTGGGCGTGG + Intronic
1019464887 7:1182255-1182277 CGGGAGGGGCAAAGTGGGCAAGG + Intergenic
1019575448 7:1735513-1735535 CTGGGAGGGCTGACTCGGCGGGG - Intronic
1022015257 7:26343925-26343947 ATGGAGGGACTAAGTGGGGGTGG - Intronic
1028581716 7:92416019-92416041 CTAGAAGGGCTATGTGGATGGGG - Intergenic
1029448870 7:100629513-100629535 CAGGAAGGGCCAAGTGGGGAGGG - Intronic
1037100226 8:15033939-15033961 CTGCATGGGCTAAGTGGTCAAGG + Intronic
1040486159 8:47873858-47873880 CTGGAAAGGGTAAGAGGGAGGGG + Intronic
1041248807 8:55914690-55914712 CTGGAAGGGTAAGGTGAGCGAGG - Intronic
1051075309 9:13226453-13226475 CAGCTAGGGCTAAGTGGGTGAGG - Intronic
1051162503 9:14224074-14224096 CTGGAAGGCGTAATTGGACGAGG - Intronic
1056763269 9:89429184-89429206 CTGGGAGGGCTGACTGGGCAGGG - Intronic
1057200645 9:93137935-93137957 CAGGCAGGGCTCAGTGGGAGGGG + Intergenic
1057260005 9:93577745-93577767 CGGCAAGGGCCAAGAGGGCGGGG - Intronic
1057509140 9:95663260-95663282 CAGGAAGGGCTAAGGGAGTGCGG - Intergenic
1060826168 9:126689262-126689284 CTGGTGGGGCGAAGTGGGCAGGG - Intronic
1061517613 9:131098581-131098603 CCAGAAGAGCTAAGAGGGCGGGG + Intronic
1062388490 9:136324703-136324725 CAGGGAGGGCTAAGTGACCGAGG + Intergenic
1187009632 X:15266452-15266474 CTTGAAGAGCTAAGTGGAGGAGG - Intronic
1187195237 X:17077418-17077440 ATGGAAGGGCTCAGGGGGCAAGG - Intronic
1188104922 X:26138333-26138355 CTGGGAGAGCAAAGTGGGCGTGG + Exonic
1190869927 X:54415967-54415989 CTGGAGGGGCCAAGGGGGAGGGG + Intergenic
1191657436 X:63613682-63613704 CTTGAAGGGCTTTGTGGGTGTGG - Intergenic
1197695110 X:129541027-129541049 GTGGAAGGACTGAATGGGCGGGG + Intronic
1200228533 X:154432564-154432586 CTGGAAGGGCTGTGAGGGGGTGG - Intronic