ID: 915165488

View in Genome Browser
Species Human (GRCh38)
Location 1:153945939-153945961
Sequence TGGGGCAGAGGGCGCGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 167}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165468_915165488 25 Left 915165468 1:153945891-153945913 CCACTCCGGGTCCCCACGCCCGC 0: 1
1: 0
2: 4
3: 26
4: 271
Right 915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 167
915165472_915165488 14 Left 915165472 1:153945902-153945924 CCCCACGCCCGCGTGCCGGGTGA 0: 1
1: 0
2: 0
3: 4
4: 48
Right 915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 167
915165481_915165488 -1 Left 915165481 1:153945917-153945939 CCGGGTGACGGGAAGTTCGGGTT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 167
915165469_915165488 20 Left 915165469 1:153945896-153945918 CCGGGTCCCCACGCCCGCGTGCC 0: 1
1: 0
2: 1
3: 18
4: 185
Right 915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 167
915165477_915165488 7 Left 915165477 1:153945909-153945931 CCCGCGTGCCGGGTGACGGGAAG 0: 1
1: 0
2: 0
3: 3
4: 61
Right 915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 167
915165474_915165488 12 Left 915165474 1:153945904-153945926 CCACGCCCGCGTGCCGGGTGACG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 167
915165478_915165488 6 Left 915165478 1:153945910-153945932 CCGCGTGCCGGGTGACGGGAAGT 0: 1
1: 0
2: 0
3: 5
4: 55
Right 915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 167
915165473_915165488 13 Left 915165473 1:153945903-153945925 CCCACGCCCGCGTGCCGGGTGAC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 167
915165467_915165488 26 Left 915165467 1:153945890-153945912 CCCACTCCGGGTCCCCACGCCCG 0: 1
1: 0
2: 3
3: 15
4: 152
Right 915165488 1:153945939-153945961 TGGGGCAGAGGGCGCGCCGAGGG 0: 1
1: 0
2: 2
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165488 Original CRISPR TGGGGCAGAGGGCGCGCCGA GGG Intronic