ID: 915165692

View in Genome Browser
Species Human (GRCh38)
Location 1:153946636-153946658
Sequence CCGCGGCCCGGAGCGGGGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 301}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165692_915165703 9 Left 915165692 1:153946636-153946658 CCAACCCCCGCTCCGGGCCGCGG 0: 1
1: 1
2: 3
3: 40
4: 301
Right 915165703 1:153946668-153946690 CTACCCCCACCCCTCCTCCTCGG 0: 1
1: 1
2: 11
3: 86
4: 697
915165692_915165706 13 Left 915165692 1:153946636-153946658 CCAACCCCCGCTCCGGGCCGCGG 0: 1
1: 1
2: 3
3: 40
4: 301
Right 915165706 1:153946672-153946694 CCCCACCCCTCCTCCTCGGCCGG 0: 1
1: 1
2: 4
3: 48
4: 483
915165692_915165709 16 Left 915165692 1:153946636-153946658 CCAACCCCCGCTCCGGGCCGCGG 0: 1
1: 1
2: 3
3: 40
4: 301
Right 915165709 1:153946675-153946697 CACCCCTCCTCCTCGGCCGGCGG 0: 1
1: 0
2: 1
3: 22
4: 173
915165692_915165715 28 Left 915165692 1:153946636-153946658 CCAACCCCCGCTCCGGGCCGCGG 0: 1
1: 1
2: 3
3: 40
4: 301
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165692 Original CRISPR CCGCGGCCCGGAGCGGGGGT TGG (reversed) Exonic