ID: 915165697

View in Genome Browser
Species Human (GRCh38)
Location 1:153946642-153946664
Sequence CGGCGCCCGCGGCCCGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 2, 2: 5, 3: 54, 4: 405}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165697_915165709 10 Left 915165697 1:153946642-153946664 CCCGCTCCGGGCCGCGGGCGCCG 0: 1
1: 2
2: 5
3: 54
4: 405
Right 915165709 1:153946675-153946697 CACCCCTCCTCCTCGGCCGGCGG 0: 1
1: 0
2: 1
3: 22
4: 173
915165697_915165706 7 Left 915165697 1:153946642-153946664 CCCGCTCCGGGCCGCGGGCGCCG 0: 1
1: 2
2: 5
3: 54
4: 405
Right 915165706 1:153946672-153946694 CCCCACCCCTCCTCCTCGGCCGG 0: 1
1: 1
2: 4
3: 48
4: 483
915165697_915165715 22 Left 915165697 1:153946642-153946664 CCCGCTCCGGGCCGCGGGCGCCG 0: 1
1: 2
2: 5
3: 54
4: 405
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165697_915165703 3 Left 915165697 1:153946642-153946664 CCCGCTCCGGGCCGCGGGCGCCG 0: 1
1: 2
2: 5
3: 54
4: 405
Right 915165703 1:153946668-153946690 CTACCCCCACCCCTCCTCCTCGG 0: 1
1: 1
2: 11
3: 86
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165697 Original CRISPR CGGCGCCCGCGGCCCGGAGC GGG (reversed) Exonic