ID: 915165699

View in Genome Browser
Species Human (GRCh38)
Location 1:153946648-153946670
Sequence TAGCGGCGGCGCCCGCGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165699_915165706 1 Left 915165699 1:153946648-153946670 CCGGGCCGCGGGCGCCGCCGCTA 0: 1
1: 0
2: 2
3: 31
4: 286
Right 915165706 1:153946672-153946694 CCCCACCCCTCCTCCTCGGCCGG 0: 1
1: 1
2: 4
3: 48
4: 483
915165699_915165715 16 Left 915165699 1:153946648-153946670 CCGGGCCGCGGGCGCCGCCGCTA 0: 1
1: 0
2: 2
3: 31
4: 286
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165699_915165709 4 Left 915165699 1:153946648-153946670 CCGGGCCGCGGGCGCCGCCGCTA 0: 1
1: 0
2: 2
3: 31
4: 286
Right 915165709 1:153946675-153946697 CACCCCTCCTCCTCGGCCGGCGG 0: 1
1: 0
2: 1
3: 22
4: 173
915165699_915165703 -3 Left 915165699 1:153946648-153946670 CCGGGCCGCGGGCGCCGCCGCTA 0: 1
1: 0
2: 2
3: 31
4: 286
Right 915165703 1:153946668-153946690 CTACCCCCACCCCTCCTCCTCGG 0: 1
1: 1
2: 11
3: 86
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165699 Original CRISPR TAGCGGCGGCGCCCGCGGCC CGG (reversed) Exonic