ID: 915165700

View in Genome Browser
Species Human (GRCh38)
Location 1:153946653-153946675
Sequence GGGGGTAGCGGCGGCGCCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 0, 2: 6, 3: 60, 4: 700}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165700_915165709 -1 Left 915165700 1:153946653-153946675 CCGCGGGCGCCGCCGCTACCCCC 0: 1
1: 0
2: 6
3: 60
4: 700
Right 915165709 1:153946675-153946697 CACCCCTCCTCCTCGGCCGGCGG 0: 1
1: 0
2: 1
3: 22
4: 173
915165700_915165706 -4 Left 915165700 1:153946653-153946675 CCGCGGGCGCCGCCGCTACCCCC 0: 1
1: 0
2: 6
3: 60
4: 700
Right 915165706 1:153946672-153946694 CCCCACCCCTCCTCCTCGGCCGG 0: 1
1: 1
2: 4
3: 48
4: 483
915165700_915165703 -8 Left 915165700 1:153946653-153946675 CCGCGGGCGCCGCCGCTACCCCC 0: 1
1: 0
2: 6
3: 60
4: 700
Right 915165703 1:153946668-153946690 CTACCCCCACCCCTCCTCCTCGG 0: 1
1: 1
2: 11
3: 86
4: 697
915165700_915165715 11 Left 915165700 1:153946653-153946675 CCGCGGGCGCCGCCGCTACCCCC 0: 1
1: 0
2: 6
3: 60
4: 700
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165700 Original CRISPR GGGGGTAGCGGCGGCGCCCG CGG (reversed) Exonic