ID: 915165701

View in Genome Browser
Species Human (GRCh38)
Location 1:153946662-153946684
Sequence AGGAGGGGTGGGGGTAGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1927
Summary {0: 1, 1: 0, 2: 10, 3: 178, 4: 1738}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165701_915165709 -10 Left 915165701 1:153946662-153946684 CCGCCGCTACCCCCACCCCTCCT 0: 1
1: 0
2: 10
3: 178
4: 1738
Right 915165709 1:153946675-153946697 CACCCCTCCTCCTCGGCCGGCGG 0: 1
1: 0
2: 1
3: 22
4: 173
915165701_915165715 2 Left 915165701 1:153946662-153946684 CCGCCGCTACCCCCACCCCTCCT 0: 1
1: 0
2: 10
3: 178
4: 1738
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165701 Original CRISPR AGGAGGGGTGGGGGTAGCGG CGG (reversed) Exonic