ID: 915165701 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:153946662-153946684 |
Sequence | AGGAGGGGTGGGGGTAGCGG CGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 1927 | |||
Summary | {0: 1, 1: 0, 2: 10, 3: 178, 4: 1738} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
915165701_915165709 | -10 | Left | 915165701 | 1:153946662-153946684 | CCGCCGCTACCCCCACCCCTCCT | 0: 1 1: 0 2: 10 3: 178 4: 1738 |
||
Right | 915165709 | 1:153946675-153946697 | CACCCCTCCTCCTCGGCCGGCGG | 0: 1 1: 0 2: 1 3: 22 4: 173 |
||||
915165701_915165715 | 2 | Left | 915165701 | 1:153946662-153946684 | CCGCCGCTACCCCCACCCCTCCT | 0: 1 1: 0 2: 10 3: 178 4: 1738 |
||
Right | 915165715 | 1:153946687-153946709 | TCGGCCGGCGGCCGTGACCCTGG | 0: 1 1: 0 2: 0 3: 17 4: 110 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
915165701 | Original CRISPR | AGGAGGGGTGGGGGTAGCGG CGG (reversed) | Exonic | ||