ID: 915165702

View in Genome Browser
Species Human (GRCh38)
Location 1:153946665-153946687
Sequence AGGAGGAGGGGTGGGGGTAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4438
Summary {0: 1, 1: 3, 2: 33, 3: 502, 4: 3899}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165702_915165715 -1 Left 915165702 1:153946665-153946687 CCGCTACCCCCACCCCTCCTCCT 0: 1
1: 3
2: 33
3: 502
4: 3899
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165702 Original CRISPR AGGAGGAGGGGTGGGGGTAG CGG (reversed) Exonic