ID: 915165704

View in Genome Browser
Species Human (GRCh38)
Location 1:153946671-153946693
Sequence CGGCCGAGGAGGAGGGGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 871
Summary {0: 1, 1: 0, 2: 3, 3: 97, 4: 770}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165704_915165715 -7 Left 915165704 1:153946671-153946693 CCCCCACCCCTCCTCCTCGGCCG 0: 1
1: 0
2: 3
3: 97
4: 770
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165704 Original CRISPR CGGCCGAGGAGGAGGGGTGG GGG (reversed) Exonic