ID: 915165705

View in Genome Browser
Species Human (GRCh38)
Location 1:153946672-153946694
Sequence CCGGCCGAGGAGGAGGGGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 1, 2: 4, 3: 51, 4: 427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165705_915165715 -8 Left 915165705 1:153946672-153946694 CCCCACCCCTCCTCCTCGGCCGG 0: 1
1: 1
2: 4
3: 51
4: 427
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165705 Original CRISPR CCGGCCGAGGAGGAGGGGTG GGG (reversed) Exonic