ID: 915165707

View in Genome Browser
Species Human (GRCh38)
Location 1:153946673-153946695
Sequence GCCGGCCGAGGAGGAGGGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 540}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165707_915165715 -9 Left 915165707 1:153946673-153946695 CCCACCCCTCCTCCTCGGCCGGC 0: 1
1: 0
2: 1
3: 44
4: 540
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165707 Original CRISPR GCCGGCCGAGGAGGAGGGGT GGG (reversed) Exonic