ID: 915165708 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:153946674-153946696 |
| Sequence | CGCCGGCCGAGGAGGAGGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 444 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 42, 4: 399} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 915165708_915165715 | -10 | Left | 915165708 | 1:153946674-153946696 | CCACCCCTCCTCCTCGGCCGGCG | 0: 1 1: 0 2: 2 3: 42 4: 399 |
||
| Right | 915165715 | 1:153946687-153946709 | TCGGCCGGCGGCCGTGACCCTGG | 0: 1 1: 0 2: 0 3: 17 4: 110 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 915165708 | Original CRISPR | CGCCGGCCGAGGAGGAGGGG TGG (reversed) | Exonic | ||