ID: 915165715

View in Genome Browser
Species Human (GRCh38)
Location 1:153946687-153946709
Sequence TCGGCCGGCGGCCGTGACCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 110}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915165692_915165715 28 Left 915165692 1:153946636-153946658 CCAACCCCCGCTCCGGGCCGCGG 0: 1
1: 1
2: 3
3: 40
4: 301
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165708_915165715 -10 Left 915165708 1:153946674-153946696 CCACCCCTCCTCCTCGGCCGGCG 0: 1
1: 0
2: 2
3: 42
4: 399
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165695_915165715 24 Left 915165695 1:153946640-153946662 CCCCCGCTCCGGGCCGCGGGCGC 0: 1
1: 0
2: 5
3: 55
4: 309
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165690_915165715 30 Left 915165690 1:153946634-153946656 CCCCAACCCCCGCTCCGGGCCGC 0: 1
1: 0
2: 1
3: 46
4: 385
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165698_915165715 21 Left 915165698 1:153946643-153946665 CCGCTCCGGGCCGCGGGCGCCGC 0: 1
1: 0
2: 5
3: 53
4: 401
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165699_915165715 16 Left 915165699 1:153946648-153946670 CCGGGCCGCGGGCGCCGCCGCTA 0: 1
1: 0
2: 2
3: 31
4: 286
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165696_915165715 23 Left 915165696 1:153946641-153946663 CCCCGCTCCGGGCCGCGGGCGCC 0: 1
1: 1
2: 4
3: 49
4: 371
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165705_915165715 -8 Left 915165705 1:153946672-153946694 CCCCACCCCTCCTCCTCGGCCGG 0: 1
1: 1
2: 4
3: 51
4: 427
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165707_915165715 -9 Left 915165707 1:153946673-153946695 CCCACCCCTCCTCCTCGGCCGGC 0: 1
1: 0
2: 1
3: 44
4: 540
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165691_915165715 29 Left 915165691 1:153946635-153946657 CCCAACCCCCGCTCCGGGCCGCG 0: 1
1: 0
2: 1
3: 10
4: 231
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165700_915165715 11 Left 915165700 1:153946653-153946675 CCGCGGGCGCCGCCGCTACCCCC 0: 1
1: 0
2: 6
3: 60
4: 700
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165701_915165715 2 Left 915165701 1:153946662-153946684 CCGCCGCTACCCCCACCCCTCCT 0: 1
1: 0
2: 10
3: 178
4: 1738
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165697_915165715 22 Left 915165697 1:153946642-153946664 CCCGCTCCGGGCCGCGGGCGCCG 0: 1
1: 2
2: 5
3: 54
4: 405
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165704_915165715 -7 Left 915165704 1:153946671-153946693 CCCCCACCCCTCCTCCTCGGCCG 0: 1
1: 0
2: 3
3: 97
4: 770
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110
915165702_915165715 -1 Left 915165702 1:153946665-153946687 CCGCTACCCCCACCCCTCCTCCT 0: 1
1: 3
2: 33
3: 502
4: 3899
Right 915165715 1:153946687-153946709 TCGGCCGGCGGCCGTGACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915165715 Original CRISPR TCGGCCGGCGGCCGTGACCC TGG Exonic