ID: 915166592

View in Genome Browser
Species Human (GRCh38)
Location 1:153951475-153951497
Sequence GAGCCGGAGCACTGAGTGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915166581_915166592 23 Left 915166581 1:153951429-153951451 CCCAAAACAGGAGATGAAGTGGA 0: 1
1: 0
2: 1
3: 29
4: 321
Right 915166592 1:153951475-153951497 GAGCCGGAGCACTGAGTGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 210
915166582_915166592 22 Left 915166582 1:153951430-153951452 CCAAAACAGGAGATGAAGTGGAG 0: 1
1: 0
2: 4
3: 18
4: 230
Right 915166592 1:153951475-153951497 GAGCCGGAGCACTGAGTGAGGGG 0: 1
1: 0
2: 0
3: 12
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915166592 Original CRISPR GAGCCGGAGCACTGAGTGAG GGG Exonic