ID: 915167658

View in Genome Browser
Species Human (GRCh38)
Location 1:153957665-153957687
Sequence CCGTCCGACCATAAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 10}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915167658_915167664 22 Left 915167658 1:153957665-153957687 CCACACAACTTATGGTCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 10
Right 915167664 1:153957710-153957732 ACCCTACCTCTCCTCCAAGGAGG 0: 1
1: 0
2: 3
3: 18
4: 142
915167658_915167663 19 Left 915167658 1:153957665-153957687 CCACACAACTTATGGTCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 10
Right 915167663 1:153957707-153957729 AAAACCCTACCTCTCCTCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 251
915167658_915167667 27 Left 915167658 1:153957665-153957687 CCACACAACTTATGGTCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 10
Right 915167667 1:153957715-153957737 ACCTCTCCTCCAAGGAGGCCAGG 0: 1
1: 0
2: 3
3: 38
4: 279
915167658_915167660 -8 Left 915167658 1:153957665-153957687 CCACACAACTTATGGTCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 10
Right 915167660 1:153957680-153957702 TCGGACGGTTACCCAGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915167658 Original CRISPR CCGTCCGACCATAAGTTGTG TGG (reversed) Intronic
912656435 1:111490109-111490131 CTGTCTGACCTTCAGTTGTGTGG - Intronic
915167658 1:153957665-153957687 CCGTCCGACCATAAGTTGTGTGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
1078164642 11:8871341-8871363 CCATCCGACCAAGAGTTGTCTGG + Intronic
1081042492 11:38228613-38228635 CCTTCAGACCATGAGTTGTCTGG + Intergenic
1084344945 11:68540575-68540597 CCGTCTGACCAAAATTTGTTAGG + Intronic
1153600203 18:6773606-6773628 CCTTCTGACCATAAGTTGCGTGG + Intronic
972836855 4:42881426-42881448 CCATCCATCCAGAAGTTGTGAGG + Intergenic
974460746 4:62184668-62184690 GCGTCAGACCATAAGTGGTTGGG - Intergenic
999212492 5:149902267-149902289 CTGTCCAAACATAAGTTTTGGGG + Intronic
1026737382 7:72957645-72957667 CCCTCAGACCATAAGTGGTGAGG + Intergenic
1027106350 7:75407423-75407445 CCCTCAGACCATAAGTGGTGAGG - Intronic
1042934760 8:74047388-74047410 ACGTCTACCCATAAGTTGTGGGG - Intergenic
1058443939 9:105036859-105036881 CCGTCAGACCATTAGTATTGGGG - Intergenic