ID: 915167660

View in Genome Browser
Species Human (GRCh38)
Location 1:153957680-153957702
Sequence TCGGACGGTTACCCAGTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915167654_915167660 20 Left 915167654 1:153957637-153957659 CCTAGAAAGCTCAGCAAACCATA 0: 1
1: 0
2: 4
3: 19
4: 169
Right 915167660 1:153957680-153957702 TCGGACGGTTACCCAGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 25
915167655_915167660 2 Left 915167655 1:153957655-153957677 CCATAGAGTTCCACACAACTTAT 0: 1
1: 0
2: 1
3: 5
4: 107
Right 915167660 1:153957680-153957702 TCGGACGGTTACCCAGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 25
915167652_915167660 27 Left 915167652 1:153957630-153957652 CCAACTCCCTAGAAAGCTCAGCA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 915167660 1:153957680-153957702 TCGGACGGTTACCCAGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 25
915167653_915167660 21 Left 915167653 1:153957636-153957658 CCCTAGAAAGCTCAGCAAACCAT 0: 1
1: 2
2: 1
3: 8
4: 187
Right 915167660 1:153957680-153957702 TCGGACGGTTACCCAGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 25
915167658_915167660 -8 Left 915167658 1:153957665-153957687 CCACACAACTTATGGTCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 10
Right 915167660 1:153957680-153957702 TCGGACGGTTACCCAGTTGTCGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915167660 Original CRISPR TCGGACGGTTACCCAGTTGT CGG Intronic
915167660 1:153957680-153957702 TCGGACGGTTACCCAGTTGTCGG + Intronic
918281949 1:183015491-183015513 TCGGGTGGATACCCAGTAGTGGG + Intergenic
1078342987 11:10514166-10514188 TAGAACAGTTACCCAGCTGTGGG + Exonic
1080609262 11:33889789-33889811 TTGGATGGATACCCAGTAGTGGG - Intronic
1082560344 11:54612381-54612403 TTGGGCGGATACCCAGTAGTGGG + Intergenic
1087604404 11:100359475-100359497 TTGGACGATTACCCAGTTTTGGG - Intergenic
1100107353 12:91191962-91191984 TTTGAGGATTACCCAGTTGTGGG - Intergenic
1102433929 12:112905588-112905610 CCGGACGGTGTCCCAGTTTTGGG - Intergenic
1116329035 14:43573009-43573031 TTGGATGGATACCCAGTAGTGGG + Intergenic
1121609545 14:95267659-95267681 TTGGATATTTACCCAGTTGTGGG - Intronic
1139371225 16:66470638-66470660 TCTGAGGGTCTCCCAGTTGTTGG + Intronic
1142835252 17:2580905-2580927 TTAGACGCTTACCCAGTGGTTGG - Intergenic
1147237421 17:39068144-39068166 TCGGCAGGTTTCCCAGTGGTTGG - Intronic
937715924 2:125032336-125032358 TTGGATGGCTACCCAGTAGTGGG + Intergenic
1171375075 20:24687061-24687083 TGGGAAGATTACCCAGTGGTGGG + Intergenic
1173716869 20:45215605-45215627 CCGGGTGGTTACCCAGTAGTGGG - Intergenic
966991688 3:185238260-185238282 TTGGACGGATCCCCAGTAGTTGG + Intronic
981414811 4:144480338-144480360 TTGGACAGATACCCAGTAGTGGG - Intergenic
989327656 5:40218421-40218443 TTGGATGGATACCCAGTAGTGGG + Intergenic
993619155 5:90147518-90147540 TCAGAGGGTTACCCAGCTGTGGG - Intergenic
996495639 5:124151983-124152005 TGGGGCAGTTACCCAGTGGTGGG - Intergenic
997102706 5:130986801-130986823 TCTCCTGGTTACCCAGTTGTCGG - Intergenic
1003685835 6:8301119-8301141 TGGGATGCTTACCCAGTGGTGGG + Intergenic
1005459516 6:26055241-26055263 TCGGACGCTTTCCATGTTGTTGG - Intergenic
1024781495 7:52855884-52855906 TCGGAAGGTCACCCAGTGTTGGG + Intergenic
1035333979 7:158113958-158113980 TCTGAGGGGTACCCAGATGTAGG - Intronic
1061760957 9:132851027-132851049 TCAGAAAGTTACCCAGTAGTAGG + Intronic
1185967498 X:4624298-4624320 CTGGATGGTTACCCAGTAGTGGG + Intergenic