ID: 915167663

View in Genome Browser
Species Human (GRCh38)
Location 1:153957707-153957729
Sequence AAAACCCTACCTCTCCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915167661_915167663 -7 Left 915167661 1:153957691-153957713 CCCAGTTGTCGGATTCAAAACCC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 915167663 1:153957707-153957729 AAAACCCTACCTCTCCTCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 251
915167658_915167663 19 Left 915167658 1:153957665-153957687 CCACACAACTTATGGTCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 10
Right 915167663 1:153957707-153957729 AAAACCCTACCTCTCCTCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 251
915167662_915167663 -8 Left 915167662 1:153957692-153957714 CCAGTTGTCGGATTCAAAACCCT 0: 1
1: 0
2: 1
3: 4
4: 73
Right 915167663 1:153957707-153957729 AAAACCCTACCTCTCCTCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 251
915167655_915167663 29 Left 915167655 1:153957655-153957677 CCATAGAGTTCCACACAACTTAT 0: 1
1: 0
2: 1
3: 5
4: 107
Right 915167663 1:153957707-153957729 AAAACCCTACCTCTCCTCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915167663 Original CRISPR AAAACCCTACCTCTCCTCCA AGG Intronic
900666487 1:3818822-3818844 AAAACCCAAACTCTGCCCCAAGG + Intronic
900946313 1:5833222-5833244 CAATCCCTACCTCTCCACCCGGG + Intergenic
903023277 1:20409524-20409546 CAAACCCTACTTATCCTCTAAGG - Intergenic
903136817 1:21314642-21314664 TAAATCCAACCTCCCCTCCAGGG + Intronic
906642226 1:47448347-47448369 CTACCCCTTCCTCTCCTCCAAGG - Intergenic
906931983 1:50178909-50178931 GAAACCCCAACTCTTCTCCAGGG + Intronic
907481440 1:54748092-54748114 ACCACCTTACATCTCCTCCAGGG + Intergenic
907573380 1:55504500-55504522 TAAACCCAGCCTCTACTCCAGGG - Intergenic
907840641 1:58154127-58154149 AAAACGCTCCCTATCCTTCAAGG + Intronic
908193238 1:61724910-61724932 CCAACTCTACCTCGCCTCCATGG + Intronic
908609163 1:65836799-65836821 AACACCCTTCCTCTCTACCATGG - Intronic
908703697 1:66928483-66928505 AAAACCCTCCTTCATCTCCATGG + Intronic
909893025 1:81031711-81031733 AAAACTCTACCTGTCTACCATGG - Intergenic
910043984 1:82889571-82889593 AAAATGCTACCCATCCTCCAAGG - Intergenic
910221993 1:84897397-84897419 GAAACCCTATCTAACCTCCAGGG - Intergenic
911172363 1:94783203-94783225 AAATCCCTACTTATCCTCTAAGG - Intergenic
911691921 1:100844703-100844725 AAAACTCCTCTTCTCCTCCAAGG - Intergenic
912665879 1:111579155-111579177 AACACCCTCCCTCCCCTCCTTGG + Intronic
913157553 1:116114881-116114903 AAAACCCTACACTTCCTCCAAGG - Intronic
915167663 1:153957707-153957729 AAAACCCTACCTCTCCTCCAAGG + Intronic
915842646 1:159227995-159228017 AAAACCCTACCTATCCTGAATGG + Intergenic
916445874 1:164871330-164871352 AAAATCCTACCTAGCTTCCAAGG - Intronic
916508932 1:165454226-165454248 AAAAGCCTTCCTCTCTGCCAAGG - Intergenic
916920530 1:169461368-169461390 AAAATCCTACCCATCCTGCATGG + Intergenic
918439370 1:184551154-184551176 AATAATCTACCTCTTCTCCATGG - Intronic
919609213 1:199724542-199724564 AAAGCGCTACCTTTCCTCCTTGG + Intergenic
921754894 1:218843611-218843633 ATCACCCCAACTCTCCTCCAGGG - Intergenic
921980136 1:221248067-221248089 ACATCCCATCCTCTCCTCCAAGG + Intergenic
922126950 1:222737241-222737263 AAAACCCTCCCCCTCTGCCAAGG + Intronic
922465450 1:225843268-225843290 AAACTCCTACTTATCCTCCAAGG - Intronic
923000203 1:230000793-230000815 AAAGCCCTCCTGCTCCTCCAGGG + Intergenic
924056837 1:240132494-240132516 ACGAGCCTACCTCTCCACCATGG - Intronic
1062932142 10:1360454-1360476 AAAACCCTGTCTCTACTTCATGG - Intronic
1062997543 10:1881234-1881256 ACAAACCTGCTTCTCCTCCATGG + Intergenic
1063757346 10:9028197-9028219 AAAATCCTATCCCTCATCCATGG + Intergenic
1063834804 10:10000533-10000555 AATCCACTACCTCTTCTCCAGGG + Intergenic
1065182356 10:23139349-23139371 AAAACCCTACCTATCCTGAATGG + Intergenic
1066199385 10:33130538-33130560 GAAATCCTACTTGTCCTCCAAGG + Intergenic
1072317875 10:94221395-94221417 ACATCCATACCTATCCTCCATGG - Intronic
1072511006 10:96124687-96124709 ACCACCCAACCCCTCCTCCAAGG - Intergenic
1074857941 10:117487088-117487110 AAATTCCTACCTGTCCTACAAGG + Intergenic
1075630779 10:123999678-123999700 AAAATAATACCTCTCCTGCATGG - Intergenic
1078072916 11:8130168-8130190 CATCCCCTACCTCTCCTTCAAGG + Intronic
1079052325 11:17173019-17173041 AAAACTCTACTTGTCCTTCAGGG + Intronic
1082110210 11:48265731-48265753 AACATCCTACCTACCCTCCATGG + Intergenic
1083781678 11:64921584-64921606 AAAACCCAAGCTCTCCACCCAGG - Intronic
1086120626 11:83301343-83301365 AAAATCCTACCCACCCTCCATGG - Intergenic
1086177560 11:83909882-83909904 AAGACTCTTCCTCTACTCCAGGG + Intronic
1087031756 11:93713368-93713390 AAAACCAGACCTGTCCTACAAGG - Intronic
1087773961 11:102240922-102240944 AACAACCCACCTCTCCTCCTGGG - Intergenic
1088084394 11:105960136-105960158 AAAACACACCCTCTCCACCAAGG - Intronic
1089652526 11:119923711-119923733 GCAACCCTCCCTCTCCTCCCAGG + Intergenic
1090677934 11:129021398-129021420 AAAACTGTATCTCTTCTCCAGGG + Intronic
1092443117 12:8527216-8527238 AAAACACACCCTCTCCACCAAGG - Intergenic
1092490412 12:8939860-8939882 AAAACCCTACCTCTCCCATTGGG - Exonic
1094054678 12:26256770-26256792 AAAACACACCCTCTCCACCAAGG + Intronic
1095237441 12:39814705-39814727 CAAACCCTGCCTATCCTTCAAGG + Intronic
1096640276 12:52988877-52988899 AAAACCCAACCTCTGCCCCTTGG - Intergenic
1096946075 12:55411299-55411321 AAAACCCTACCTCTCCCATTGGG + Intergenic
1097056609 12:56253858-56253880 AATGCCCTACCTCCCTTCCAAGG + Intronic
1097457554 12:59818616-59818638 AAAACCTAAACTCTCCCCCATGG + Intergenic
1100903252 12:99267778-99267800 TAAGTCCTACCTGTCCTCCAAGG - Intronic
1101254047 12:102959874-102959896 GAAACTCTGCTTCTCCTCCAGGG + Exonic
1102455890 12:113070548-113070570 AGAACCCTCCCCCTTCTCCATGG + Intronic
1105866031 13:24460557-24460579 AAGACCCTCCCTGACCTCCATGG + Intronic
1106187781 13:27424477-27424499 AAACCCCCGCCTCTCATCCAGGG + Intergenic
1106353171 13:28954630-28954652 AAAATCCTACCTCTGCTTCACGG - Intronic
1106459345 13:29955304-29955326 CAAAACCTCCCTCTGCTCCAAGG + Intergenic
1106590596 13:31095349-31095371 AAAACCCTTCTTCTCTTTCAAGG + Intergenic
1107037957 13:35920617-35920639 AACACCCTTCTTGTCCTCCATGG - Intronic
1107811283 13:44202070-44202092 TAAATCCTACCTCAGCTCCATGG + Intergenic
1111572762 13:90108309-90108331 AGAACCCAACCCCTCCTCCATGG - Intergenic
1112534993 13:100244690-100244712 AGATCCCTAACTCTGCTCCAGGG - Intronic
1117544256 14:56779316-56779338 AAAACCCTATCCATCCTTCATGG - Intergenic
1118020678 14:61710611-61710633 AAAACCCTATCTCTACTTAATGG - Intronic
1118292031 14:64535755-64535777 CAAACCCTATGTCTGCTCCAAGG - Intergenic
1118660125 14:67999826-67999848 AAAACCCTACTCCACCTTCAAGG - Intronic
1119417440 14:74482508-74482530 AAAAAGCTACCTCTCTGCCATGG + Intronic
1120207146 14:81599152-81599174 AAAACTCTACCGCTCTTCTAAGG - Intergenic
1121509618 14:94502651-94502673 ACCACCCTACCTCTCTTCCCTGG + Intronic
1121659023 14:95620878-95620900 GAAACCCTTCCCCTCCTCCGTGG - Intergenic
1122505023 14:102226818-102226840 CAAACCCCGCCGCTCCTCCATGG + Intronic
1126157963 15:45583188-45583210 AAAATCCTACTTCTCTTCCAAGG - Intergenic
1126246178 15:46508784-46508806 AAAAGCCTGTCTCTCCTCCCAGG + Intergenic
1126771974 15:52067112-52067134 AAAATCCTAGGTCTCCTTCAGGG - Exonic
1129508170 15:76100337-76100359 AAAATCCTATCCCTCCTTCAAGG + Intronic
1129832050 15:78676967-78676989 AAAACCCTTCCACAGCTCCAAGG - Intronic
1132426196 15:101719492-101719514 TAAACCATTCCTCTCTTCCATGG + Intronic
1132716818 16:1294693-1294715 CAGACCCCTCCTCTCCTCCAAGG + Intergenic
1136058885 16:27711152-27711174 AAAACCCCAACTTTCCCCCAAGG - Intronic
1137365518 16:47856157-47856179 AAAACCCTACTCCTCCTTTAAGG + Intergenic
1138270830 16:55694778-55694800 ATAATCCTAACTATCCTCCAAGG - Intronic
1138420257 16:56894422-56894444 AAACCCCTTCCTCTCCTCGCTGG - Intronic
1138625554 16:58248871-58248893 AAAACCCTCCCTCAGATCCAGGG + Intronic
1139782282 16:69361828-69361850 AAACCCCTCCCTCTCTTCCTTGG + Intronic
1140301911 16:73766250-73766272 TAACCCCTACCTGTCCTCAAAGG + Intergenic
1140581387 16:76235111-76235133 CAAACCCTACGTCCACTCCAAGG - Intergenic
1141970141 16:87476039-87476061 GAGACCCTGTCTCTCCTCCAGGG - Intronic
1142257962 16:89024372-89024394 AAGCCCCTGCCACTCCTCCAAGG - Intergenic
1144963674 17:19061989-19062011 AAAACGCTACCTCTCTTCCTCGG - Intergenic
1144964004 17:19064037-19064059 AAAACGCTACCTCTCTTCCTCGG + Intergenic
1144971484 17:19112537-19112559 AAAACGCTACCTCTCTTCCTCGG + Intergenic
1145247864 17:21281446-21281468 AAAACCCTACCTATCCTGAATGG - Intergenic
1146954543 17:36929736-36929758 AAAAGACTCCCTCTCCTCCCGGG - Intergenic
1147374050 17:40013745-40013767 AAAACCCACCCTCTACTCCCAGG + Intergenic
1147501404 17:40967565-40967587 CAAACCCTACCTTTTCCCCATGG - Intergenic
1148073553 17:44922404-44922426 AAAACCCAACCCCTTCTCCTTGG + Intergenic
1148149489 17:45388276-45388298 AAAACCTTTCCTCTCATCTAAGG - Intergenic
1149733155 17:58966156-58966178 AAAAGACTACCTTGCCTCCATGG - Intronic
1149778943 17:59381021-59381043 AAGTCCCTACCTCTCCTCCTTGG - Intronic
1149841028 17:59965020-59965042 GAAACCCTAACACTCCTCCAGGG - Intronic
1151949313 17:77340945-77340967 AAAGCCCTAACTCTCTTCAATGG - Intronic
1156629927 18:38954867-38954889 AAAATTCTACATCTCCTTCAAGG + Intergenic
1156766137 18:40657989-40658011 AAAACCATACTTGCCCTCCATGG + Intergenic
1157164192 18:45343172-45343194 AAAACCCTAACCCAACTCCAAGG + Intronic
1157847589 18:51017954-51017976 AAGACCCAGCCCCTCCTCCAAGG - Intronic
1157915694 18:51661566-51661588 AAAACCCTTCTTCACCACCAGGG - Intergenic
1158290837 18:55940439-55940461 AAAACCCTAAATTTCCTCCAGGG - Intergenic
1161420566 19:4174246-4174268 CCCACCCTACCCCTCCTCCATGG - Exonic
1165955547 19:39499750-39499772 GGAACCCTACCTCTGCTCCTTGG + Intronic
1166422193 19:42646153-42646175 AAATCCATACCTATGCTCCATGG + Intronic
1166695946 19:44851455-44851477 AGCCCCCAACCTCTCCTCCAGGG + Intronic
1166939308 19:46353243-46353265 AAAATCCGACCTCTCCTCCTTGG + Intronic
1167571756 19:50292955-50292977 TCAAACCTGCCTCTCCTCCAGGG - Intronic
927376526 2:22421602-22421624 AAAAGCCTACCTCTAATCCCAGG - Intergenic
928241097 2:29587148-29587170 AATATCCTACCCCTCCCCCAAGG - Intronic
928433869 2:31241174-31241196 AAAGCCTCACCTCTCCTCCAAGG + Intronic
929538948 2:42804975-42804997 CAAACTCTCCCTCCCCTCCAAGG + Intergenic
930607220 2:53505036-53505058 AAAACCCTACCTGTCCTTGAAGG + Intergenic
930750395 2:54928739-54928761 AACACCATACCTTTCTTCCACGG - Exonic
930783797 2:55250506-55250528 AAAACCCAACATCTCATCCTAGG + Intronic
932409285 2:71535589-71535611 AAAACCCCACCCCTCCTGCCGGG - Intronic
934618700 2:95791212-95791234 TAAGCCCTCCCTCTCCTCCTTGG - Intergenic
934642193 2:96033345-96033367 TAAGCCCTCCCTCTCCTCCTTGG + Intronic
935731743 2:106070041-106070063 AAACCACCACCTCTCCTCCCTGG + Intronic
937513574 2:122627554-122627576 AAAACCCTCCCTCTCCACGGAGG + Intergenic
937597385 2:123687606-123687628 GATACACTCCCTCTCCTCCAAGG - Intergenic
937986685 2:127641225-127641247 CAGACCCTACCCCTCCTCTAAGG + Intronic
939699530 2:145372896-145372918 TAATCCCTACCTCTCCTGTATGG - Intergenic
940283028 2:152006879-152006901 CCAATCCTGCCTCTCCTCCAAGG + Intronic
940652911 2:156455017-156455039 AGACCCCTCCCTCTCCCCCAGGG - Intronic
943533780 2:189121495-189121517 AGAGCCCCACCCCTCCTCCAAGG - Intronic
946025135 2:216667254-216667276 CAAAGACTACCTCACCTCCATGG - Intergenic
946039104 2:216768811-216768833 TCAACCCTACCTCTTCTTCATGG - Intergenic
946678646 2:222189710-222189732 AAATCCCTTCCCCTGCTCCACGG + Intergenic
946817379 2:223593060-223593082 GGAAACCTACCTCTCCTCTAAGG - Intergenic
1168860218 20:1040852-1040874 AAAAACCCACCTCTTCTCCATGG + Intergenic
1169867522 20:10217688-10217710 ACAACCCTAACTGTCCTCCCTGG - Intergenic
1171430611 20:25081463-25081485 AAATCCCTGCCTCTCATCCGGGG - Intronic
1173336928 20:42119782-42119804 AAACTCATTCCTCTCCTCCAGGG + Intronic
1173604912 20:44324928-44324950 AAAAGCTTCCCTCTCCTCCCTGG - Intergenic
1173818960 20:46008643-46008665 AAAACCCTACCCCTCCCCTGAGG + Intergenic
1174143743 20:48435866-48435888 ACACCCCCACCTCTCCCCCAGGG + Intergenic
1174153726 20:48503653-48503675 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174153843 20:48504242-48504264 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174153968 20:48504928-48504950 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174154167 20:48506004-48506026 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174154210 20:48506200-48506222 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174154429 20:48507379-48507401 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174154684 20:48508752-48508774 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174154792 20:48509339-48509361 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174154834 20:48509535-48509557 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174154979 20:48510319-48510341 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174155069 20:48510808-48510830 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174155179 20:48511396-48511418 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174155621 20:48513749-48513771 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174155663 20:48513945-48513967 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1174155889 20:48515165-48515187 AAAACAAGACCTCTCCTCCCTGG + Intergenic
1175898313 20:62349945-62349967 GCCACCCCACCTCTCCTCCAGGG - Intronic
1176678893 21:9806998-9807020 GACACCCTCCCTCTCCACCATGG - Intergenic
1180226743 21:46397992-46398014 AACACGCTGCCTCTCCTCCCAGG + Exonic
1183431306 22:37767530-37767552 ACAACAGTACCTTTCCTCCATGG - Intronic
1183727252 22:39596626-39596648 AAAACCCTGCCCCTGCTCCTGGG - Intronic
950297380 3:11843558-11843580 GAAACCCTGTCTCTCCTACAAGG + Intronic
952400522 3:32959298-32959320 AAAATCATGCCTCTCCTACAAGG - Intergenic
959089164 3:101883996-101884018 AAAACCCAAACTCTTTTCCATGG - Intergenic
960565388 3:119126494-119126516 AAAACACACCCTCTCCACCAAGG + Intronic
960997389 3:123349083-123349105 ACATCCCTACCTCCCGTCCATGG + Intronic
961201960 3:125052401-125052423 AAAGCGCTTCCTTTCCTCCAGGG + Intronic
961393967 3:126573228-126573250 TAAACCCCTCCTCTCCACCAGGG + Intronic
962076879 3:132091290-132091312 AAAGCCCTTGCTCTGCTCCATGG + Intronic
965127812 3:164651683-164651705 AAAATCCTACCTATCCCTCAAGG - Intergenic
965687173 3:171316430-171316452 AAAATCCTACCGATCCTCCAAGG - Intronic
966250454 3:177859969-177859991 AAAACACACCCTCTCCACCAAGG - Intergenic
967325445 3:188234139-188234161 AAACCCCCACCCCTGCTCCAAGG + Intronic
967975236 3:195030797-195030819 AAGACCCCACTTCTCCTCGAGGG + Intergenic
968028402 3:195462364-195462386 AAAACCTAACCACTCCTCAAGGG - Intergenic
968779732 4:2571306-2571328 AGAACCTGCCCTCTCCTCCAGGG - Intronic
969052031 4:4379973-4379995 AAAACGCCACCTCTCCTCCAAGG - Intronic
970445339 4:16119284-16119306 AAAAACCTCCCTATCTTCCAGGG + Intergenic
970568105 4:17352259-17352281 TACAGCCTGCCTCTCCTCCAGGG - Intergenic
971853226 4:32010649-32010671 AAAACACACCCTCTCCACCAAGG + Intergenic
974292379 4:59948827-59948849 ATAACACTGCCTCTCATCCAAGG - Intergenic
976807371 4:89063298-89063320 AAAATACAACCTCTCCACCAAGG - Intronic
976825186 4:89252918-89252940 AAAAGCCTACCTATTCTTCAAGG + Intronic
979197785 4:117941321-117941343 AAAGCACAACCTCTCCACCAAGG - Intergenic
984106306 4:175551527-175551549 AAAACCCTATCCCACCGCCAAGG + Intergenic
985067578 4:186138515-186138537 AGTGCCCTTCCTCTCCTCCAGGG + Intronic
986728902 5:10620242-10620264 AGACCCCCAGCTCTCCTCCATGG - Intronic
989092099 5:37743892-37743914 AAAACACACCCTCTCCACCAAGG + Intronic
990338178 5:54795408-54795430 AAAATCTTACCTCTCCTACAGGG - Intergenic
990443686 5:55872100-55872122 AAATTCCTTCCTCACCTCCAAGG - Intronic
992439334 5:76784462-76784484 AGACCCCTTCCTCTCCACCAAGG - Intergenic
993530697 5:89021214-89021236 AAAACCCCAACTCTACACCAAGG + Intergenic
994344574 5:98669215-98669237 AAAACACACCCTCTCCACCAAGG + Intergenic
994679115 5:102863347-102863369 GAAACTCTAACTGTCCTCCAAGG + Intronic
996271980 5:121616736-121616758 CAAACCCTACGTTTGCTCCAAGG + Intergenic
996762607 5:127001486-127001508 CAAAACCTGCCTCTCCCCCATGG + Intronic
997337888 5:133120678-133120700 CAAACCCTCCCTCTTCACCAAGG + Intergenic
998036464 5:138921032-138921054 GAGACCCTACCCCTCCTCCCTGG - Intronic
998380104 5:141718200-141718222 AAACCCTTACTTATCCTCCAAGG - Intergenic
998588603 5:143454007-143454029 AAAACCATATCACTACTCCAGGG + Intergenic
998627279 5:143860205-143860227 AACCCACTACCTCTGCTCCAAGG + Intergenic
999655845 5:153809891-153809913 CCAACCCTACCTCTTCTTCAAGG - Intronic
1000027915 5:157376103-157376125 AAAACCCTGCCCCTCCTCTCAGG + Intronic
1000430665 5:161148242-161148264 AATACCCTACCTCACCCCCAAGG - Intergenic
1000666465 5:164003658-164003680 AAAACCCTACCTATTCACAATGG + Intergenic
1002210569 5:177596528-177596550 AGAATCCTTCCTCTCCTTCATGG - Intergenic
1003179210 6:3777729-3777751 AGAAACCTATCTCTCCTCCAGGG - Intergenic
1003623169 6:7720343-7720365 AAAAGCCCAAATCTCCTCCAAGG + Intergenic
1004512425 6:16293881-16293903 AAAACTCTAGCTCTCATCTAAGG - Intronic
1004528195 6:16428907-16428929 AAAATCCTTCCTCTACTTCAGGG - Intronic
1007146511 6:39639450-39639472 AAATCCCAACCTCTCCTTAAAGG + Intronic
1007636460 6:43302600-43302622 ACACCCCTGGCTCTCCTCCAAGG + Intronic
1008367843 6:50703727-50703749 AAAACCCTACCTATCCTGAATGG + Intergenic
1008394810 6:50994068-50994090 CAAATCCTAGCACTCCTCCAAGG - Intergenic
1008773596 6:55008913-55008935 AAAACACACCCTCTCCACCAAGG - Intergenic
1011138605 6:84128110-84128132 AAACACCTACCTCTCTGCCATGG - Intronic
1011192844 6:84750980-84751002 AGAACCCTTCCTCTTCTCCAAGG + Intronic
1013585008 6:111570642-111570664 AAAACCTAAGCTCTCCTCCAGGG + Intronic
1014084823 6:117330444-117330466 AAAACACACCCTCTCCACCAGGG + Intronic
1014217003 6:118762046-118762068 AAAACCCTTCCTATGCTTCAAGG - Intergenic
1014769863 6:125448320-125448342 AAAATCCTACCTACCCTTCAAGG - Intergenic
1015279742 6:131420235-131420257 AAAACCCTCCCTCTCCAGCTTGG - Intergenic
1016071869 6:139748442-139748464 ACCACCCTATCTCTGCTCCAAGG - Intergenic
1018115288 6:160577823-160577845 GATTCCCTATCTCTCCTCCAAGG - Intronic
1027944088 7:84723199-84723221 AAAACACAACCTCTCTACCAAGG + Intergenic
1029600680 7:101561780-101561802 AAAACACCTCCTCTCCTCCTTGG + Intergenic
1029655176 7:101919393-101919415 ACAACCCGACGTCACCTCCACGG - Intronic
1029791450 7:102847216-102847238 AAAAGCCTACCCCTGCTCTAGGG + Intronic
1029850455 7:103456581-103456603 AGAACACTTCTTCTCCTCCAAGG - Intergenic
1031411079 7:121440890-121440912 CAAACCCTACGTCCGCTCCAAGG - Intergenic
1034429239 7:151032879-151032901 ATTACCCTACCTCCCCTCCCTGG - Intronic
1034737693 7:153444147-153444169 AAAACCCAAACTCTCCTCTCAGG - Intergenic
1035626707 8:1076395-1076417 AATACCGTACGTCTCCTGCATGG - Intergenic
1036563173 8:9914541-9914563 AAAACTCTACCTCTTCTCACCGG - Intergenic
1038584422 8:28776409-28776431 AAAACTCTGCCTCTGCTCCTTGG - Intronic
1039685869 8:39801538-39801560 AAAACACACCCTCTCCACCAAGG - Intronic
1041644634 8:60238878-60238900 CAAATCCTACCTGTCCTCCTAGG + Intronic
1045301955 8:100918989-100919011 AAAACCCTACCTATCCTGAATGG - Exonic
1045412695 8:101934459-101934481 TTAACCCTTACTCTCCTCCAGGG - Intronic
1047091092 8:121576503-121576525 AAAACTCTTCCTCTTCTCCCGGG - Intergenic
1047344057 8:124010099-124010121 AGAACAAGACCTCTCCTCCACGG - Intronic
1048258594 8:132925372-132925394 CATAGCCTACCTGTCCTCCAGGG + Intronic
1049045872 8:140151141-140151163 ACACCCCTACTTCTCCTCAAGGG + Intronic
1050459054 9:5861699-5861721 AAAACCCTTCCTCTCTTCTCTGG - Intergenic
1057973666 9:99581188-99581210 AAATCCCTACTTGTCCCCCAGGG + Intergenic
1058248904 9:102667571-102667593 AACACCAGACCTCTCCTACAAGG - Intergenic
1059133993 9:111785902-111785924 ACAAACATACCTCTCGTCCATGG + Intronic
1059483260 9:114608555-114608577 TAAACCCTACCTCTCCAACAAGG - Intergenic
1059746156 9:117203877-117203899 AAAACACACCCTCTCCACCAAGG - Intronic
1059976206 9:119720098-119720120 AAGACTCTCCCTTTCCTCCAAGG + Intergenic
1060429138 9:123533839-123533861 GAACCACTCCCTCTCCTCCACGG + Intronic
1060429859 9:123541677-123541699 AAAATCCTGCCACGCCTCCATGG + Intronic
1061484715 9:130914459-130914481 AGGACCCTGCCCCTCCTCCAGGG - Intronic
1203664064 Un_KI270754v1:9534-9556 GACACCCTCCCTCTCCACCATGG - Intergenic
1186430991 X:9503911-9503933 AAAACACACCCTCTCCACCAAGG + Intronic
1188415909 X:29934141-29934163 AAAACCCAACCAGTCCTTCAAGG - Intronic
1189512210 X:41674118-41674140 AAAACCCTGCCTATCCTGAATGG - Intronic
1189856010 X:45225744-45225766 AAAAACCCACCTATCCTGCAAGG + Intergenic
1192487495 X:71541961-71541983 AAAACCCTACTCATCCTTCAAGG + Intronic
1193240821 X:79167037-79167059 GAAATCCTGCCTGTCCTCCAAGG - Intergenic
1195975044 X:110517512-110517534 AAAACCCTACTACTCATGCAAGG - Intergenic
1198383645 X:136107051-136107073 AAACCCCTACCTTTTCTGCACGG + Intergenic
1198500494 X:137240383-137240405 AAAATTCTTCCTCTCTTCCATGG - Intergenic
1199470860 X:148194129-148194151 AAAATTCTATCTCTCCTTCAAGG + Intergenic
1199641805 X:149869244-149869266 TAAACCCCAACTCTCCTCCAGGG - Intergenic
1200305589 X:155023243-155023265 AAAACCCTACATCTTTACCATGG + Intronic
1202336595 Y:23818250-23818272 CCAGCCCTACCTTTCCTCCAGGG - Intergenic
1202534171 Y:25851821-25851843 CCAGCCCTACCTTTCCTCCAGGG + Intergenic