ID: 915167664

View in Genome Browser
Species Human (GRCh38)
Location 1:153957710-153957732
Sequence ACCCTACCTCTCCTCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915167662_915167664 -5 Left 915167662 1:153957692-153957714 CCAGTTGTCGGATTCAAAACCCT 0: 1
1: 0
2: 1
3: 4
4: 73
Right 915167664 1:153957710-153957732 ACCCTACCTCTCCTCCAAGGAGG 0: 1
1: 0
2: 3
3: 18
4: 142
915167658_915167664 22 Left 915167658 1:153957665-153957687 CCACACAACTTATGGTCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 10
Right 915167664 1:153957710-153957732 ACCCTACCTCTCCTCCAAGGAGG 0: 1
1: 0
2: 3
3: 18
4: 142
915167661_915167664 -4 Left 915167661 1:153957691-153957713 CCCAGTTGTCGGATTCAAAACCC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 915167664 1:153957710-153957732 ACCCTACCTCTCCTCCAAGGAGG 0: 1
1: 0
2: 3
3: 18
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915167664 Original CRISPR ACCCTACCTCTCCTCCAAGG AGG Intronic
902633441 1:17719545-17719567 ACACTCTCTCTCCTCCGAGGAGG - Intergenic
903155336 1:21439009-21439031 ATCCTATCTCTCCACCAAGGTGG - Intergenic
904359508 1:29962807-29962829 GCCCTATCTCCTCTCCAAGGGGG + Intergenic
905498161 1:38412667-38412689 ACCCTAACTCTTTTCCAACGTGG - Intergenic
906642222 1:47448344-47448366 CCCCTTCCTCTCCTCCAAGGGGG - Intergenic
907473434 1:54689556-54689578 AGCCTGCCTCTCCTCTCAGGAGG - Intronic
908193241 1:61724913-61724935 ACTCTACCTCGCCTCCATGGGGG + Intronic
910221992 1:84897394-84897416 ACCCTATCTAACCTCCAGGGAGG - Intergenic
911288301 1:96025177-96025199 ACCCTATTTCTCCCTCAAGGAGG - Intergenic
912487673 1:110041869-110041891 ACCGTTCTCCTCCTCCAAGGAGG - Intronic
912665880 1:111579158-111579180 ACCCTCCCTCCCCTCCTTGGAGG + Intronic
915100406 1:153495181-153495203 ACCCAACCACTGCTCCCAGGAGG + Intergenic
915167664 1:153957710-153957732 ACCCTACCTCTCCTCCAAGGAGG + Intronic
919970422 1:202573304-202573326 AGCCTACCTTTATTCCAAGGTGG + Intronic
920311964 1:205053919-205053941 CCTCTGCCTCTCCTCCAAGCTGG - Intronic
924083232 1:240420962-240420984 TCCTTCCCTCTCCTCCATGGAGG - Intronic
1062916978 10:1248045-1248067 ACCCAGCCTCTGCTGCAAGGCGG - Intronic
1063168603 10:3486149-3486171 ACCCTACCCCACCTGCCAGGAGG + Intergenic
1063331625 10:5165371-5165393 ACCCTACAACACCTCCTAGGGGG + Intergenic
1068867682 10:61911955-61911977 ACCCCAACCCTCCACCAAGGAGG + Intronic
1069265966 10:66457929-66457951 CCTCTACCTATCTTCCAAGGAGG - Intronic
1072511004 10:96124684-96124706 ACCCAACCCCTCCTCCAAGGTGG - Intergenic
1076272584 10:129166896-129166918 ACACTCTCTCTCCTCCAAGCTGG + Intergenic
1083197738 11:61099114-61099136 ACCCTGCCTCTTCTTCAAGGGGG + Intergenic
1084041961 11:66547521-66547543 ACCCCACCTCGTCTCCAGGGTGG + Intronic
1086546149 11:87969907-87969929 ACCCTACCTCTCCTCAAATATGG - Intergenic
1089556942 11:119320223-119320245 ACCCTCCCTCTCTCCCATGGTGG - Intronic
1089642194 11:119855038-119855060 ACCCTACCTCTGCTTCCAAGAGG - Intergenic
1091625471 12:2117813-2117835 CCCCTTCCTCTCCTCCAGGTGGG - Intronic
1091696831 12:2633364-2633386 ACCCTACCCCTTCTCCACAGAGG - Intronic
1094029292 12:25992623-25992645 TCCCTGCCTCTCCTTCAAGTTGG - Intronic
1095366926 12:41418707-41418729 ATCAGAGCTCTCCTCCAAGGAGG - Intronic
1096609329 12:52790580-52790602 ACGCTAGATCCCCTCCAAGGGGG - Intronic
1096685005 12:53282458-53282480 ACCATACATGTCATCCAAGGGGG - Intronic
1102612227 12:114122338-114122360 ACACTGCCTCTCCTCCTTGGTGG - Intergenic
1104170553 12:126276150-126276172 GCCCCTCCTCTCCTCCAAGCTGG + Intergenic
1105237504 13:18572093-18572115 AGACTTCCTCTTCTCCAAGGCGG + Intergenic
1112699105 13:101983881-101983903 CCCCAAGCTCTCCTCCTAGGGGG - Intronic
1113612361 13:111656419-111656441 ACCATGCCTCTCATCCAATGAGG + Intronic
1115161542 14:30401965-30401987 ACTCTGCCTCTCCTCCCAGCAGG - Intergenic
1116764871 14:49058066-49058088 TCCCTTACTCTCCTCCAAAGAGG - Intergenic
1117165820 14:53032063-53032085 ACCCTACCTGTTTCCCAAGGTGG - Intergenic
1119147691 14:72331757-72331779 TCCCTTCCTCTCCTCCATGCAGG - Intronic
1122330538 14:100909483-100909505 CCCCTGCATCTCCTCCAAGATGG + Intergenic
1122428685 14:101626394-101626416 ACTGTACCTCTCCTTTAAGGAGG - Intergenic
1122466176 14:101935077-101935099 ACCCTACATCTGCTCCACCGAGG + Intergenic
1122505024 14:102226821-102226843 ACCCCGCCGCTCCTCCATGGAGG + Intronic
1122893503 14:104743909-104743931 ACCCTGCCTGTCCTCCATGCTGG - Intronic
1202906006 14_GL000194v1_random:72873-72895 ACCCTATCTCCCTTCCGAGGAGG + Intergenic
1124617326 15:31251053-31251075 GCCCAACCTCTGCCCCAAGGGGG - Intergenic
1125578639 15:40770927-40770949 TCCCTTCCTCTCCTTCAAAGTGG + Exonic
1127267941 15:57376419-57376441 CCCCTGCCCCTCCTCCCAGGAGG + Intronic
1127363109 15:58262360-58262382 CACCTACCTCACCTCCAGGGTGG + Intronic
1130549524 15:84881109-84881131 CCCCTACCTGTCCTCCATGGGGG - Intergenic
1131075935 15:89494985-89495007 ACCTTTCCTCTCCTCAAGGGGGG - Intronic
1132108608 15:99085503-99085525 ACCCTTCCTCTCCTCCCCAGAGG + Intergenic
1135597740 16:23756291-23756313 ACCTCCCCCCTCCTCCAAGGTGG + Intronic
1135884719 16:26295542-26295564 ACCCTACCCCTCCTTCAACTGGG - Intergenic
1136407686 16:30058070-30058092 ACCCATCCTCTCTCCCAAGGAGG - Intronic
1142594388 17:1022475-1022497 ACCCTGCCTCTCCTCCCTCGAGG + Intronic
1143417185 17:6758708-6758730 ACCCCATCTCTCCTGCAGGGAGG - Intronic
1143417231 17:6758899-6758921 ACCCCATCTCTCCTGCAGGGAGG - Intronic
1143417270 17:6759042-6759064 ACCCCATCTCTCCTGCAGGGAGG - Intronic
1145296954 17:21599689-21599711 ACCCTCTCTCTCCTTCAAGAGGG + Intergenic
1145764058 17:27445834-27445856 ACCCTCCCTCACCTCCAGGCTGG - Intergenic
1146847525 17:36192612-36192634 TCCCTAGCTCTCCTCCCTGGGGG - Intronic
1147476728 17:40719033-40719055 ACCCTCCCTCTCCACCGAGCAGG + Intergenic
1147838169 17:43349989-43350011 CTCTTTCCTCTCCTCCAAGGAGG - Intergenic
1148818858 17:50348780-50348802 CTCCTTCCTCTCCTCCAAGGAGG - Intronic
1157663315 18:49464742-49464764 ACCTGGCCACTCCTCCAAGGAGG + Intergenic
1159242696 18:65763037-65763059 ACCCTACCTTTCCTACATAGAGG - Exonic
1160429495 18:78801688-78801710 ACCCTGCCTCTCCTCCCAGATGG - Intergenic
1160832273 19:1109502-1109524 CTTCTACCTCTCCTACAAGGTGG - Exonic
1161342325 19:3750119-3750141 TCTCTCCCTCTCCTCCAAGGTGG + Exonic
1162809017 19:13153321-13153343 GCTCTACCTCTCGGCCAAGGTGG + Exonic
1165351876 19:35280048-35280070 CCCCTGCCTCTCCTCCAACATGG - Intergenic
1165363885 19:35352265-35352287 ACCCTACAACGCCTCCAACGTGG + Exonic
1166390750 19:42407599-42407621 ACCCTACCTGTCCTTCACGCAGG + Exonic
1167456057 19:49597178-49597200 ACCGAACATCTCCTCCATGGTGG - Exonic
925390919 2:3493326-3493348 TCCCTGCCTGTCCCCCAAGGAGG - Intergenic
925709463 2:6724746-6724768 ACCTTCTCTGTCCTCCAAGGAGG + Intergenic
926569953 2:14518791-14518813 ACAGTACTTCTCTTCCAAGGTGG + Intergenic
927376525 2:22421599-22421621 AGCCTACCTCTAATCCCAGGCGG - Intergenic
928001537 2:27527119-27527141 ACACCACCTCTCCTCCAATGTGG + Intergenic
932165935 2:69507087-69507109 ACCATCACACTCCTCCAAGGAGG + Intronic
935676858 2:105601812-105601834 TCCCTACCCTTCCTCCAAGTTGG - Intergenic
941143489 2:161814760-161814782 ACCCTCCCTCTCCTCTCTGGTGG - Intronic
941584248 2:167337025-167337047 ACCCTGCCCCTCTTCCATGGAGG + Intergenic
942448896 2:176097178-176097200 AACCTACCATTTCTCCAAGGCGG - Intergenic
944518667 2:200540633-200540655 CCCCTCCCTCTCCTCTATGGTGG - Intronic
1170316240 20:15044091-15044113 AGCCTATCTCCCCTCCATGGAGG + Intronic
1171202894 20:23256071-23256093 CTCCTGCCTCTCCTCCATGGAGG - Intergenic
1171891818 20:30724346-30724368 ACCCTATCTCCCTTCCGAGGAGG - Intergenic
1172169573 20:32920836-32920858 TCCCTACCTCCCCTCCCAGAGGG - Intronic
1172189541 20:33053744-33053766 CCCCTTACTCGCCTCCAAGGAGG + Intergenic
1173867261 20:46320342-46320364 AACCCACCTCTCCTCCCTGGGGG + Intergenic
1176517186 21:7794529-7794551 AGCCTACCTCAACTCCAATGGGG - Intergenic
1176625361 21:9087629-9087651 ACCCTATCTCCCTTCCGAGGAGG + Intergenic
1176781494 21:13200371-13200393 AGACTTCCTCTTCTCCAAGGCGG + Intergenic
1178222439 21:30675299-30675321 ACCCTGACTCTCCACCAAGCTGG + Intergenic
1178651214 21:34424541-34424563 AGCCTACCTCAACTCCAATGGGG - Intergenic
1183290429 22:36998791-36998813 ACCCTTCCTTTCTTCCCAGGTGG + Intronic
1183705359 22:39472259-39472281 ACACTGCCTCTCCTGCAAGGGGG - Intronic
1183746717 22:39695977-39695999 ACCCTGCCCCTACTCCCAGGAGG - Intergenic
950297381 3:11843561-11843583 ACCCTGTCTCTCCTACAAGGTGG + Intronic
953927825 3:46991289-46991311 AGCCTACCTTTCCTCCAGCGAGG - Exonic
955550298 3:60077435-60077457 AGCCAACCACTTCTCCAAGGAGG - Intronic
960684923 3:120286291-120286313 ACCATCTCTCTCCTCCATGGGGG + Intergenic
961545699 3:127631287-127631309 ACCCCACCTCTCCCCTAAGCAGG - Intronic
965608857 3:170524049-170524071 ACCCTACCTCTCCCCAAAACAGG - Intronic
967157990 3:186711061-186711083 AGTCTACCTGTACTCCAAGGAGG + Intergenic
967975237 3:195030800-195030822 ACCCCACTTCTCCTCGAGGGTGG + Intergenic
973731040 4:53822547-53822569 ACCCTCCCTCTGCTCCAAAAAGG + Intronic
974062308 4:57046393-57046415 ACTCTACCTTTCTTCCAAGAAGG + Intronic
980871253 4:138613733-138613755 ACACTGCCTTTTCTCCAAGGAGG + Intergenic
982869466 4:160559475-160559497 AACCTACCTTTCCTGCAAGGAGG - Intergenic
983129315 4:163995447-163995469 GCCCAACCCCTCCTCCAAGGAGG - Intronic
985514988 5:337773-337795 AACCTACACCTCCTCCAATGAGG - Intronic
990347676 5:54885423-54885445 TCCCTGCCTCCCCTCCAAAGAGG - Intergenic
993938081 5:94027386-94027408 CCCCACCCTCACCTCCAAGGAGG + Intronic
996366158 5:122703465-122703487 ACACTAGCACTGCTCCAAGGGGG + Intergenic
998036463 5:138921029-138921051 ACCCTACCCCTCCTCCCTGGAGG - Intronic
1003264416 6:4552761-4552783 ACCCTACCTCTCCTCTGGGAGGG + Intergenic
1005682966 6:28225253-28225275 TGCCGACCTCTCCTCGAAGGCGG - Exonic
1006801275 6:36761153-36761175 TCCCTAAATCTCCTCAAAGGAGG + Intronic
1006851550 6:37102456-37102478 GCCCTCCCTCCCCTCCACGGTGG + Intergenic
1006897794 6:37481975-37481997 AGCCTGCCTCCCCTCCAAGGAGG + Intronic
1007112295 6:39319959-39319981 GCCCTGCCTATTCTCCAAGGCGG - Intronic
1008030597 6:46689030-46689052 CTCCTCCCTCTCCTCCCAGGTGG - Exonic
1012457704 6:99425654-99425676 ACTCAACCCCTTCTCCAAGGCGG - Intergenic
1015726557 6:136305504-136305526 ACCCTTCCTCTCCTGGAAGAAGG - Intergenic
1015882446 6:137882611-137882633 TCCCTATCTCATCTCCAAGGAGG - Exonic
1016774026 6:147884326-147884348 TCTCTACCTGTCCACCAAGGAGG - Intergenic
1016819726 6:148335923-148335945 CCCCTACCACTCATCCAATGAGG - Intronic
1021928952 7:25560851-25560873 TCTCTACCTCTCATCCAGGGCGG + Intergenic
1022048028 7:26638817-26638839 TCCCCACCTATGCTCCAAGGTGG - Exonic
1023888845 7:44378517-44378539 ACCCTCCTGGTCCTCCAAGGTGG - Intergenic
1026529445 7:71184618-71184640 TCCCTTCCTCTCTCCCAAGGTGG + Intronic
1026978789 7:74514667-74514689 CCCCAACCCCTGCTCCAAGGAGG - Intronic
1027450584 7:78326821-78326843 ACCATACCTCTCCACGGAGGAGG - Intronic
1031985907 7:128164603-128164625 ACACTCCCTATCCTCCAAGGTGG - Intergenic
1033926149 7:146462996-146463018 GGCCTACCTCACCTGCAAGGGGG - Intronic
1034449343 7:151129085-151129107 ACCCTCGCTCTCCTCCCAGGAGG - Intronic
1036680238 8:10866836-10866858 GCCCTACCTCCCCTCCAAGCAGG - Intergenic
1036722853 8:11193094-11193116 ACCCTACCTTTCCTCCAAGAGGG + Intronic
1044343816 8:91079402-91079424 TCTCTACCTTTCCTCCATGGAGG - Intronic
1044385960 8:91588432-91588454 ACATTACCCCTCCTTCAAGGTGG - Intergenic
1047044229 8:121033938-121033960 ATCTTACCTCTCCTTCAAAGTGG + Intergenic
1047852002 8:128867052-128867074 ACCTTGCCTCACCTCAAAGGAGG + Intergenic
1047924109 8:129665963-129665985 ACCCTAACTGACCTACAAGGTGG + Intergenic
1049045876 8:140151144-140151166 CCCCTACTTCTCCTCAAGGGGGG + Intronic
1051906794 9:22104575-22104597 ACCGTACCTCTCCTACATGCTGG + Intergenic
1053052755 9:34975669-34975691 ATCCTAGCTCTGCTCCAAGTGGG - Intronic
1053269833 9:36742463-36742485 TCCCTACCCCTCCCCCAAAGGGG + Intergenic
1053906931 9:42852126-42852148 ACCCTATCTCCCTTCCGAGGAGG + Intergenic
1054356996 9:64071351-64071373 ACCCTATCTCCCTTCCGAGGAGG + Intergenic
1059467540 9:114478566-114478588 ACCCTGCACCTCCTGCAAGGAGG - Exonic
1060432256 9:123560748-123560770 ATCCCACCTCTACTCCAAGAGGG + Intronic
1062171381 9:135136763-135136785 ACCCGGCCTCAGCTCCAAGGAGG - Intergenic
1203748535 Un_GL000218v1:58090-58112 ACCCTATCTCCCTTCCGAGGAGG + Intergenic
1203561185 Un_KI270744v1:59930-59952 ACCCTATCTCCCTTCCGAGGAGG - Intergenic
1187298732 X:18027565-18027587 CCCCTACCTCTCAGCCAACGAGG + Intergenic
1190016503 X:46831998-46832020 ACCCAGTCTCTCCTGCAAGGTGG - Intergenic
1191865149 X:65698002-65698024 ACCATACCTCCCCTCCATAGAGG - Intronic