ID: 915167667

View in Genome Browser
Species Human (GRCh38)
Location 1:153957715-153957737
Sequence ACCTCTCCTCCAAGGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915167662_915167667 0 Left 915167662 1:153957692-153957714 CCAGTTGTCGGATTCAAAACCCT 0: 1
1: 0
2: 1
3: 4
4: 73
Right 915167667 1:153957715-153957737 ACCTCTCCTCCAAGGAGGCCAGG 0: 1
1: 0
2: 3
3: 38
4: 279
915167658_915167667 27 Left 915167658 1:153957665-153957687 CCACACAACTTATGGTCGGACGG 0: 1
1: 0
2: 0
3: 4
4: 10
Right 915167667 1:153957715-153957737 ACCTCTCCTCCAAGGAGGCCAGG 0: 1
1: 0
2: 3
3: 38
4: 279
915167661_915167667 1 Left 915167661 1:153957691-153957713 CCCAGTTGTCGGATTCAAAACCC 0: 1
1: 0
2: 0
3: 5
4: 56
Right 915167667 1:153957715-153957737 ACCTCTCCTCCAAGGAGGCCAGG 0: 1
1: 0
2: 3
3: 38
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915167667 Original CRISPR ACCTCTCCTCCAAGGAGGCC AGG Intronic
900503510 1:3017957-3017979 ACCCTACCACCAAGGAGGCCTGG - Intergenic
901067338 1:6500553-6500575 ACCTCCCCTCCAGGCAGACCTGG + Intronic
901165701 1:7220293-7220315 CCCTGTCCTTCGAGGAGGCCTGG - Intronic
901200690 1:7465474-7465496 GCTTCTCATCCAAGGAGACCAGG + Intronic
902550858 1:17218852-17218874 ACCCCTCTTCCCAGGAGGGCAGG + Intronic
902764084 1:18603406-18603428 ACCTCTCCTCCCAGCAGGCCAGG + Intergenic
903646431 1:24898880-24898902 ACCTTGCCAGCAAGGAGGCCTGG - Intergenic
903754406 1:25650989-25651011 AGAACTCCTCCAAGGAGACCTGG + Intronic
904322099 1:29704378-29704400 GCCTCTCCTCCTAGATGGCCAGG - Intergenic
904632203 1:31850786-31850808 GCCATTCCTCCAAGGAGCCCTGG + Intergenic
904767583 1:32862338-32862360 ACCTCTCCCCTAAGGAGCCTTGG + Exonic
904770511 1:32878601-32878623 CTCACTCCTCCAAGGAAGCCTGG + Intergenic
910400363 1:86831984-86832006 GCCATTTCTCCAAGGAGGCCTGG - Intergenic
910909714 1:92220167-92220189 ACCATTTCTCCAAGGAGCCCTGG + Intronic
912459184 1:109819800-109819822 ACTTCTCCTACAAGGAGACCAGG + Intergenic
913013366 1:114708010-114708032 ACTTCTCCTCCAGGGAAGTCAGG + Exonic
914492547 1:148161295-148161317 GCCTCTGCTGAAAGGAGGCCTGG - Intergenic
915100409 1:153495186-153495208 ACCACTGCTCCCAGGAGGCCAGG + Intergenic
915167667 1:153957715-153957737 ACCTCTCCTCCAAGGAGGCCAGG + Intronic
915622423 1:157093903-157093925 ACCTCTCCTCCAAGGGCACTCGG + Intronic
916608757 1:166369124-166369146 ACCTCTCCCCCAAAGAGGGGAGG + Intergenic
919344955 1:196363386-196363408 ACCAATACTCCAAGGAGCCCTGG + Intronic
920135999 1:203769867-203769889 TCCTCTCCTCCAAGCAAGCCAGG + Intronic
920525578 1:206663699-206663721 GCCATTCCTCCAAGGATGCCAGG + Intronic
921087424 1:211808876-211808898 ACCTCTCCCCCAAAGTAGCCTGG + Intronic
921729965 1:218566768-218566790 ACCACTTCTCCAAGAAGCCCTGG - Intergenic
922183997 1:223258053-223258075 CTCTGTCATCCAAGGAGGCCTGG + Intronic
1062916975 10:1248040-1248062 GCCTCTGCTGCAAGGCGGCCTGG - Intronic
1063452781 10:6162824-6162846 GCCACTCCTCCAAGGATCCCTGG + Intronic
1064097498 10:12434870-12434892 AACTCTCCTGCAGGGAGGTCAGG - Intronic
1065216650 10:23455612-23455634 TTCTTTCCTCCAAGGAGGCAAGG + Intergenic
1065517655 10:26540776-26540798 ACCTCTCCTCCACGGATAACAGG - Intronic
1065805969 10:29394217-29394239 ATCTCTCCTCTCAGGAGCCCAGG + Intergenic
1065942814 10:30580355-30580377 ATCTCTCCTCTCAGGAGCCCAGG - Intergenic
1066179053 10:32942147-32942169 CTCTTTGCTCCAAGGAGGCCTGG - Intronic
1066441168 10:35440337-35440359 ACCTCTGCTCCAGAGTGGCCAGG - Intronic
1068655968 10:59577000-59577022 GCATGTCCTGCAAGGAGGCCAGG - Intergenic
1069592279 10:69649665-69649687 GCCCCTCATCCAAGCAGGCCTGG - Intergenic
1069983947 10:72271197-72271219 AAGTCTCCTGCAAGGAGGCCTGG - Intergenic
1070654729 10:78263538-78263560 AGCTCTCCTCCCTGGAGGCAAGG + Intergenic
1071508658 10:86247819-86247841 ACTCCTCCTTCAAGGAGGCCTGG + Intronic
1071675161 10:87648717-87648739 ACTACTTCTCCAAGGAGCCCTGG + Intergenic
1072682290 10:97516200-97516222 GCCTCAGCTCCCAGGAGGCCAGG - Intronic
1072728389 10:97828754-97828776 ACCACTCCTCCCAGGATGGCTGG + Intergenic
1074714370 10:116204485-116204507 ATCACTTCTCCAAGGAGTCCTGG - Intronic
1075040618 10:119104354-119104376 TCCCCTGCACCAAGGAGGCCGGG - Intronic
1076192072 10:128490030-128490052 ACCCCTATTCCAAGGGGGCCAGG - Intergenic
1076286473 10:129302522-129302544 ACTACTTCTCCAAGGAGTCCTGG - Intergenic
1076736998 10:132463385-132463407 GCCTCTTCTCCAAGGTTGCCAGG + Intergenic
1076832029 10:133000329-133000351 ACCTCTGCTCCACGCAGGGCAGG + Intergenic
1077068697 11:657228-657250 GCCCCTTCTCCAAGGAGCCCCGG - Intronic
1077237727 11:1489920-1489942 GCCCCTTCTCCAAGGAGCCCTGG + Intronic
1077300573 11:1844652-1844674 ACCTCTCTTCCGAGGAGCCCTGG - Intergenic
1077699884 11:4431573-4431595 GTCTTTCCTCCAAGGAGGCAAGG - Intergenic
1078187708 11:9066415-9066437 ACAACACCTCCCAGGAGGCCAGG - Intronic
1078495319 11:11811410-11811432 TCCTCTCCTCCAGGGAAGGCCGG - Intergenic
1083833782 11:65250857-65250879 AGCTCACATCCAACGAGGCCAGG - Intergenic
1083923521 11:65792849-65792871 ACCTCTTCTCCCAGGAGGACAGG - Intronic
1084663002 11:70558110-70558132 AGCTGCCCACCAAGGAGGCCTGG + Intronic
1085042690 11:73335777-73335799 ACCTCTGCTGCCAGGAAGCCTGG + Intronic
1085305373 11:75482746-75482768 TTCCCTCCTCCATGGAGGCCCGG + Intronic
1089284032 11:117394334-117394356 TCCTCTCCTGCAAGGAGGGTGGG - Exonic
1090147267 11:124338989-124339011 ACATCAACTCCAAGGAGGGCAGG - Intergenic
1090261230 11:125322113-125322135 GACTCTCCTTCAAGGACGCCAGG - Intronic
1090268580 11:125370345-125370367 ACCTCTCCTGCAGGTTGGCCTGG - Intronic
1090934155 11:131326944-131326966 GCCTCTCCTCACAGGAGGCAAGG + Intergenic
1091230909 11:133987435-133987457 TCCCAGCCTCCAAGGAGGCCAGG + Intergenic
1094059684 12:26300522-26300544 ACCACTCCTGCAAGGATGCAAGG - Intergenic
1095318580 12:40797293-40797315 ACCTATCCTGCAAGGAAGACTGG + Intronic
1095988740 12:48018833-48018855 GCCTTTCCTCCAAGGGGGCATGG - Intergenic
1096159309 12:49364075-49364097 ATCTCTCCTCCAAGGAGAGCAGG - Intergenic
1096647819 12:53047902-53047924 ACCCCTCCTCCGCGGCGGCCGGG + Intronic
1098087160 12:66858720-66858742 TCCTCTACTCCAAGGAGACATGG + Intergenic
1098973586 12:76879314-76879336 CCTTCCCCTCCAGGGAGGCCCGG + Intergenic
1104753049 12:131251975-131251997 TCCTCTCCACATAGGAGGCCAGG - Intergenic
1105391324 13:19981532-19981554 ACCATTTCTCCAAGGAGCCCTGG + Intronic
1105947147 13:25199876-25199898 ACCATTTCTCCAAGGAGCCCTGG - Intergenic
1108269940 13:48749617-48749639 ACCTCTCCTCCCCCGATGCCAGG + Intergenic
1112247459 13:97747733-97747755 CCCTCACCTCCCCGGAGGCCTGG - Intergenic
1112494580 13:99894979-99895001 TCCTCTCCTCCAGGGACGGCTGG + Exonic
1112597343 13:100819981-100820003 ACCTCTTTTCCAAGGAGACAAGG - Intergenic
1113490002 13:110684063-110684085 ACCTATGCTCCAAGGCTGCCCGG + Intronic
1113876344 13:113597102-113597124 AACCCTCCTCCAGGGTGGCCTGG - Intronic
1115648092 14:35384149-35384171 CGATCTCCTCCAAGGAGGTCAGG - Intergenic
1117894688 14:60470987-60471009 AGCTCTCTTCCAAGGAGCTCTGG - Intronic
1118821586 14:69349470-69349492 CCCTCTTCTCCCAGGAGGACAGG + Intronic
1119708851 14:76806661-76806683 ACCACTCGTCCCAGAAGGCCTGG - Exonic
1121098905 14:91236266-91236288 TCCTCTCCTCCATGGAGCTCCGG + Intronic
1121308276 14:92921038-92921060 TTCTGTCCTCCAGGGAGGCCAGG + Intergenic
1121500616 14:94434027-94434049 CCCTCTCCTCCCATGAGGCTGGG - Intergenic
1121695132 14:95906134-95906156 ACCACTTCTCCAAGGAGCCCTGG + Intergenic
1122161004 14:99783836-99783858 ACCACTCATCCCAGAAGGCCTGG - Intronic
1122955434 14:105068154-105068176 ACCTGTCCTCCTGGGAGGCTGGG - Intergenic
1124181966 15:27484626-27484648 GCCACTTCTCCAAGGAGCCCTGG - Intronic
1124341269 15:28890561-28890583 GCATCTCCTCCAACTAGGCCAGG - Intronic
1126775601 15:52097912-52097934 ACCCTTTCTCCAAGGAGTCCTGG - Intergenic
1127265518 15:57357998-57358020 ATCACTGCTCCAGGGAGGCCTGG - Intergenic
1127267946 15:57376424-57376446 GCCCCTCCTCCCAGGAGGGCGGG + Intronic
1127338714 15:58018076-58018098 ACCATTTCTCCAAGGAGCCCTGG - Intronic
1127534877 15:59880801-59880823 AGCTCTCTTCCAAGCAGGCAGGG + Intergenic
1127535145 15:59883235-59883257 TCCTCTCCTCCAAGAATACCAGG - Intergenic
1128139193 15:65286780-65286802 ACGTGTCCTCCGCGGAGGCCTGG + Exonic
1128157554 15:65401456-65401478 ACCACTCCACCCAGGGGGCCAGG - Intronic
1128555165 15:68626799-68626821 ACCGCTGCTCCAGAGAGGCCAGG + Intronic
1128925061 15:71647879-71647901 GCCTCCCCTCCCACGAGGCCTGG - Intronic
1129086119 15:73094029-73094051 ACCATTCCTTCAAGGAGCCCTGG + Intronic
1129696658 15:77744087-77744109 ACCTCTCCCCAAACGAGGCCTGG + Intronic
1132115229 15:99131176-99131198 GCATCTCCTCCAAGGAGCCCCGG + Exonic
1132203821 15:99973067-99973089 ACCCTACCTGCAAGGAGGCCGGG - Exonic
1132279812 15:100602840-100602862 ACCTCTGCCCCAAGGCTGCCCGG + Exonic
1132573707 16:655414-655436 ACCTGGCCTTCAAGCAGGCCCGG + Exonic
1133234229 16:4380375-4380397 TTCCCTCCTCCAAGGAGGGCGGG + Intronic
1133319884 16:4906518-4906540 AATTCTACTCCAAGCAGGCCGGG - Intronic
1134417440 16:14056582-14056604 ACCACCTCTCCAAGGAGCCCTGG + Intergenic
1135589537 16:23695196-23695218 TCACCTCCTGCAAGGAGGCCCGG + Exonic
1137286794 16:47022795-47022817 ACCATTTCTCCAAGGAGCCCTGG + Intergenic
1137618443 16:49859772-49859794 GCCACTCCTCCAAGCAGGGCAGG - Intergenic
1138628463 16:58272859-58272881 ACCATTTCTCCAAGGAGGCTTGG + Intronic
1139558814 16:67729013-67729035 TGGTCTCCTCCAAAGAGGCCGGG - Intronic
1139953992 16:70684830-70684852 TCCTCTCCCCAAATGAGGCCAGG - Intronic
1140540382 16:75751521-75751543 ACCTTTTTTCTAAGGAGGCCTGG - Intronic
1141134312 16:81455824-81455846 ACCTTCCCTTCAGGGAGGCCTGG + Intronic
1141436121 16:84000869-84000891 CCCTCCCCTCCAAGGATGCCTGG - Intronic
1142430410 16:90023213-90023235 CCCTCTACACCAAGGAGGCCCGG + Intronic
1143417181 17:6758703-6758725 ATCTCTCCTGCAGGGAGGACTGG - Intronic
1143417227 17:6758894-6758916 ATCTCTCCTGCAGGGAGGACTGG - Intronic
1143417266 17:6759037-6759059 ATCTCTCCTGCAGGGAGGACTGG - Intronic
1143475368 17:7200023-7200045 ACCCTTCTTCCAAGGAGCCCAGG + Intronic
1146442868 17:32912459-32912481 TTCACTCCTCCAAGGAGGACGGG + Intergenic
1146835699 17:36108794-36108816 CATTTTCCTCCAAGGAGGCCAGG + Intergenic
1146850330 17:36216063-36216085 CATTTTCCTCCAAGGAGGCCAGG + Intronic
1147120165 17:38330982-38331004 AGGTCTCCTCCAGGTAGGCCTGG + Exonic
1147335329 17:39724024-39724046 CCCTCTCCTGCTAGGAGGACAGG + Intronic
1147507714 17:41036350-41036372 ACCCATACTCCATGGAGGCCTGG - Intergenic
1148019947 17:44547162-44547184 ACCACCCCACCAAGGAGGACTGG + Intergenic
1148737198 17:49871486-49871508 ACCTCTGCTGCAGGGAGGGCTGG + Intergenic
1148742685 17:49901832-49901854 ATCACTCCTCCAGGGAGCCCTGG + Intergenic
1148900459 17:50872077-50872099 ACCTCTACTGCAATGAAGCCTGG - Intergenic
1150261420 17:63795028-63795050 ACCTCTCCTCCAAGGAAGTAGGG + Intronic
1150379956 17:64712727-64712749 ACCTCTCCTCTTCAGAGGCCCGG + Intergenic
1150776771 17:68087428-68087450 ACCTCTCCTCTTCAGAGGCCCGG - Intergenic
1152230227 17:79110629-79110651 ACCCCTCCTCCAAGGCTGACTGG - Intronic
1152771792 17:82174255-82174277 AGCTCTCCTCCTGGGAGCCCAGG - Intronic
1156295188 18:35783066-35783088 CACTCTCCTCCAAGGATGACCGG - Intergenic
1156633916 18:39004366-39004388 ACCACTTCTCCCAGGAGTCCTGG - Intergenic
1157533770 18:48443500-48443522 TGCTCCCCTCCAGGGAGGCCAGG + Intergenic
1158213396 18:55074722-55074744 ACCACTTCTCCAAGGAGCCCTGG - Intergenic
1159999006 18:74998100-74998122 ACCAGTCATCCAAGGAGGGCTGG + Intronic
1161056093 19:2191303-2191325 AACTCTTCTCCAAGCAGGCATGG - Intronic
1161084933 19:2330613-2330635 ATGTCACCACCAAGGAGGCCCGG + Intronic
1161660688 19:5544145-5544167 CCCTCTCCCCCAGGGAGGCCCGG + Intergenic
1162807231 19:13144323-13144345 CCCTCTCCTCCTAGGGGGCGAGG + Exonic
1163095391 19:15053649-15053671 ACCTTTCCCCCAAACAGGCCTGG - Intronic
1164121119 19:22266142-22266164 ACCTCTCCCCCTAGGGGGTCAGG - Intergenic
1164388485 19:27795863-27795885 AGCACCCCTCCAAGGAGGTCAGG - Intergenic
1164608570 19:29617331-29617353 CCCTCTCCCCCAAGGAGACATGG + Intergenic
1165489028 19:36112781-36112803 ACCTCTGCTCCCAGGGGCCCTGG + Exonic
1167055911 19:47111845-47111867 ACCTATCATCCAAGTAGGACAGG + Intronic
1167531616 19:50021267-50021289 ACCCCTCCTCCCAGGAGTCAGGG + Intronic
1167592422 19:50411310-50411332 CCCTTTCCACCAAGGAGGCTGGG - Intronic
1168170664 19:54586562-54586584 ACCCCTCCTCCATGGAGCCTGGG + Intronic
1168525518 19:57085573-57085595 GCCACTTCTCCAAGGAGCCCTGG + Intergenic
1168584735 19:57583484-57583506 ACGTCTCCTCCAGGGGGGCCGGG - Intronic
926710355 2:15874687-15874709 ACCTCTCCTCCCAGGCAGCAAGG + Intergenic
928875859 2:36038515-36038537 GCCACTTCTCCAAGGAGGCCTGG + Intergenic
929533789 2:42768006-42768028 AACCCTGCTCCAAGCAGGCCTGG - Intronic
930766868 2:55093631-55093653 ACCTCTCCCTCCACGAGGCCAGG + Intronic
932452883 2:71827026-71827048 TTATCTCCTCCTAGGAGGCCTGG - Intergenic
932656931 2:73618459-73618481 ACCTCCACTCCATGGTGGCCTGG - Intergenic
933239990 2:79909638-79909660 GCCTCTCCTCCAGGGACGGCCGG - Exonic
933521198 2:83376473-83376495 GCCACTTCTCCAAGGAGTCCTGG + Intergenic
935947713 2:108301294-108301316 AGCTCTCCCCAAAGGAGGCCAGG + Intronic
936018435 2:108976902-108976924 GCCACTTCTCCAAGGAGTCCTGG + Intronic
936522065 2:113217740-113217762 ACCTCACCTCCCAGGGGCCCAGG + Exonic
936710277 2:115123121-115123143 TTCTTTCCTCCAAGGAGGCAAGG - Intronic
937010875 2:118561608-118561630 ACCTCTTCTCCAAGAGGCCCTGG - Intergenic
937126516 2:119478342-119478364 ACCCCTCGCCCCAGGAGGCCAGG + Intronic
937147272 2:119658451-119658473 ACCATTTCTCCAAGGAGCCCTGG + Intronic
937240191 2:120455682-120455704 ACCACTTCTTCAAGGAGCCCTGG - Intergenic
941388775 2:164885762-164885784 ACCACTTCTCCAAAGAGCCCTGG + Intergenic
942414257 2:175741748-175741770 CTCTCTCCACCAAAGAGGCCTGG - Intergenic
943189231 2:184654462-184654484 ACCTCTGCAGCAAGGAGCCCAGG - Intronic
944632651 2:201643014-201643036 ACCTCTCCTCGGAGGAGTCTAGG + Intronic
944662687 2:201934366-201934388 ACCTCTCCTCAAAGGGCTCCAGG - Intergenic
946193816 2:218021745-218021767 ACATGTCCCCCAAGGAGACCAGG + Intergenic
946449635 2:219768833-219768855 ACCTGACCTCCAGGGAGGCTGGG - Intergenic
947165356 2:227256050-227256072 ACCTCACTTCCAGGGAAGCCAGG - Exonic
947995722 2:234525586-234525608 ACCTCTCCTCCTGGGAGCCACGG - Intergenic
948373603 2:237505777-237505799 TCCTGTCCTCAAGGGAGGCCCGG - Intronic
948409364 2:237747274-237747296 ACTTCTCCTCCAACGACACCTGG - Intronic
1169167385 20:3435865-3435887 CCCTCTCCTCCAGTGGGGCCTGG + Intergenic
1170818931 20:19739619-19739641 ACATCAGCTCCAAGGAGGACCGG + Intergenic
1171202890 20:23256066-23256088 GCCTCTCCTCCATGGAGGGGAGG - Intergenic
1172193397 20:33075841-33075863 TCCTCTCCTCCAAGTGTGCCTGG + Intergenic
1172204968 20:33156844-33156866 TCCTCTCCCCCAAGCAGGCGGGG + Intergenic
1172969340 20:38862042-38862064 GCCTCTCCTCCAAGGAGACTGGG - Intronic
1173021004 20:39268361-39268383 TCCTGGGCTCCAAGGAGGCCAGG + Intergenic
1174587094 20:51617822-51617844 ACCTGTCCTCCTCGGAGGCCGGG + Intronic
1175368493 20:58471223-58471245 TCCCCTCCACCAAGGAGCCCTGG + Intronic
1175400482 20:58697328-58697350 GACTTGCCTCCAAGGAGGCCAGG - Intronic
1179930587 21:44568596-44568618 ACCTGGCCTCGGAGGAGGCCAGG - Intronic
1180081710 21:45490308-45490330 CCCTCTCTGCCAGGGAGGCCGGG - Exonic
1180142409 21:45900431-45900453 GCCTCTCCACTAAGAAGGCCAGG - Intronic
1181045329 22:20211578-20211600 ACCTCTCCTCCCAGGATGCCTGG - Intergenic
1182954719 22:34411876-34411898 ACCACTTCTTCAAGGAGTCCTGG - Intergenic
1183086474 22:35490264-35490286 ATCTCTGCTGCAGGGAGGCCAGG + Intergenic
1183170643 22:36185238-36185260 ACCTCTCCTTCCAGGCAGCCTGG - Intergenic
1183291325 22:37003622-37003644 ACCTCCCATCCATTGAGGCCAGG + Intronic
1183403184 22:37616815-37616837 AGCCCTCCTCCAAGGGGCCCTGG - Intronic
1183779468 22:39989521-39989543 GCCTCTCCTCCCAGTGGGCCTGG + Intergenic
1184078291 22:42198403-42198425 ACCAGTCCTCCATGGATGCCAGG - Intronic
954135019 3:48578487-48578509 CCCTGTTCTCCACGGAGGCCTGG + Exonic
954196268 3:48998940-48998962 ACCTCCTCTCCAATGAGGCGTGG - Intronic
954272281 3:49519213-49519235 ACCTCTCCTCGAAGGTGGTCAGG + Intronic
954375686 3:50193068-50193090 CCCCCTCCAGCAAGGAGGCCAGG - Intronic
954461809 3:50631043-50631065 ACCTCTCCTCCTCAGAGGCTCGG - Intronic
955550296 3:60077430-60077452 ACCACTTCTCCAAGGAGGTCTGG - Intronic
956212687 3:66818043-66818065 AGGTCTCCTCCTAGGAAGCCTGG + Intergenic
960597094 3:119416082-119416104 AACTCTCCACAAAGAAGGCCAGG - Exonic
962473723 3:135737545-135737567 AACTCTTTTCCAAGGAGTCCGGG - Intergenic
962884044 3:139607006-139607028 ACCATTTCTCCAAGGAGCCCTGG + Intronic
962955389 3:140261522-140261544 ACTGCTTCTCCAAGGAGCCCTGG + Intronic
963066160 3:141266122-141266144 TCCACTGCTCCAAGGAGCCCTGG - Intronic
966218578 3:177527928-177527950 TTCTTTCCTCCAAGGAGGCAAGG + Intergenic
966504733 3:180686890-180686912 GCCATTTCTCCAAGGAGGCCTGG + Intronic
966917297 3:184592128-184592150 ACTCCTCCACCCAGGAGGCCTGG - Intronic
967157991 3:186711066-186711088 ACCTGTACTCCAAGGAGGAAAGG + Intergenic
969626128 4:8306623-8306645 ACCTGTCCTCCAGGGACCCCAGG - Exonic
969627102 4:8311207-8311229 TCCTCTCCTCTAAGGAGCCATGG - Intergenic
970929097 4:21487953-21487975 ACCATTTCTCCAAGGAGTCCTGG + Intronic
971013411 4:22463536-22463558 ACCTATGCTCCAAGGAAGTCTGG + Intronic
972003660 4:34070780-34070802 ACCCTTTCTCCAAGGAGCCCTGG - Intergenic
975767208 4:77681591-77681613 TTCTTTCCTCCAAGGAGGCAAGG - Intergenic
978530811 4:109711354-109711376 ACCCCTGCTCCAAAGAGCCCTGG - Exonic
983786119 4:171731900-171731922 ACCTCTCCTCCTGTGAGGACGGG - Intergenic
984787984 4:183586923-183586945 GCCTGTCATCCAGGGAGGCCAGG + Intergenic
985067686 4:186139273-186139295 GCCACTCCTCCATGGAGCCCTGG + Intronic
986064711 5:4223823-4223845 TCCTCTCCTCAAAGCAGGCGAGG + Intergenic
987397454 5:17438121-17438143 CCCTTTCTTCCAAGGAGGCAGGG + Intergenic
991192067 5:63886087-63886109 ACCCCTCCTCCCTGGAGGTCAGG + Intergenic
992549363 5:77846597-77846619 ACCTCCCAGCCAGGGAGGCCTGG + Intronic
993007152 5:82441022-82441044 ACCTAGCCTCAAAGGAGGCTGGG - Intergenic
993900317 5:93580233-93580255 TCCTCCCCTCCAAGGAGGCGCGG + Intergenic
993938924 5:94035133-94035155 GCCTTTTCTCCAAGGAGCCCTGG + Intronic
994122908 5:96136453-96136475 GCCACTTCTCCAAGGAGCCCTGG + Intergenic
995751044 5:115453571-115453593 ACCTCACCTGGAATGAGGCCTGG - Intergenic
997871960 5:137514159-137514181 GCATCTCCTCCAAGGAGGGCAGG - Intronic
998060797 5:139117384-139117406 ACCTGCCCTCAAAGGATGCCTGG + Intronic
998214711 5:140228477-140228499 ACCTCTCCTCCAAGCTGACCAGG - Intronic
1002072815 5:176690468-176690490 CCCTCTCCTCCATGGAGGTCGGG + Intergenic
1003031658 6:2606374-2606396 AACTTTCCTCCAAGGTGGCAAGG - Intergenic
1003828135 6:9975055-9975077 TCCTCTCCTCCCTGGAGGCCAGG + Intronic
1005707674 6:28471432-28471454 ACCACTTCTCCAAGGAGCCCTGG + Intergenic
1005808332 6:29495919-29495941 ACCTCTTCTCCAAGATGGGCAGG + Intergenic
1006860273 6:37167725-37167747 ACCTGTAATCCAAGGAGGCTGGG + Intergenic
1006897797 6:37481980-37482002 GCCTCCCCTCCAAGGAGGGCTGG + Intronic
1007323835 6:41045440-41045462 GCCTCTCCAGGAAGGAGGCCTGG + Intronic
1007703050 6:43775425-43775447 GCCGCCCCTCCAAGGAGGGCTGG - Intronic
1012206323 6:96465254-96465276 ACTTCTTCTCCAAGGAGTCTTGG - Intergenic
1012469458 6:99554759-99554781 ACCATTTCTCCAAGGAGCCCTGG + Intronic
1014118663 6:117697214-117697236 ACCTTTCCTAAAAGGAGGACAGG + Intronic
1016966361 6:149721735-149721757 ACCATTCCTCCAAGGATCCCTGG + Intergenic
1017335933 6:153260076-153260098 GCCATTTCTCCAAGGAGGCCTGG - Intergenic
1018644256 6:165932895-165932917 ACAACCCCTCCAAGGAGACCAGG + Intronic
1019577322 7:1743776-1743798 GCTTCTGCTCCCAGGAGGCCCGG - Intronic
1019898368 7:4000452-4000474 ACCTCTCCTGCAAAGATGCTGGG - Intronic
1021291015 7:18845830-18845852 ACCTCTCTTCCTTCGAGGCCTGG - Intronic
1021874971 7:25040282-25040304 ACCACTTCTCCAAGAAGCCCTGG + Intergenic
1021968331 7:25944005-25944027 TTCTCTCCTCCAGGGAGGCCAGG - Intergenic
1022779927 7:33570188-33570210 ACCACTTCTCCAAGGAGCTCTGG - Intronic
1024605900 7:51022423-51022445 ACCTTTCCTCCAAGCATGCCTGG + Intronic
1027862020 7:83596339-83596361 ACCACTTCTCCAAGGAACCCTGG + Intronic
1031924195 7:127622444-127622466 ACCATTTCTCCAAGGAGCCCTGG + Intergenic
1031992785 7:128208867-128208889 TCCTCACCTCTAAAGAGGCCAGG + Intergenic
1032121037 7:129156808-129156830 GCCACTTCTCCAAGGAGCCCAGG + Intronic
1032864581 7:135913234-135913256 ACCACTCCTTCAAGGAGCCTTGG + Intergenic
1033446668 7:141428895-141428917 TTCTTTCCTCCAAGGAGGCAAGG + Intronic
1034325302 7:150225138-150225160 GCCACTTCTCCAAGGAGCCCTGG + Intergenic
1034767901 7:153744110-153744132 GCCACTTCTCCAAGGAGCCCTGG - Intergenic
1034916529 7:155044467-155044489 CGCTTTCCTCCAAGGAGGCAAGG + Intergenic
1034983906 7:155496065-155496087 ACCTGTCCTCCAAGGCCTCCGGG + Intronic
1035079507 7:156204259-156204281 ACCTGTCCCCCAAGGAGGGAGGG + Intergenic
1035163311 7:156967412-156967434 ACCTCACCTCTAAGGAGACCAGG - Intronic
1035782720 8:2241373-2241395 ATATGTCCTACAAGGAGGCCCGG + Intergenic
1036044194 8:5121845-5121867 TTCTTTCCTCCAAGGAGGCAAGG - Intergenic
1036631302 8:10517864-10517886 ACCTCTGCTCCTAGCGGGCCTGG + Intergenic
1037414517 8:18635256-18635278 ACCACTTCTCCAAGGAGCCTTGG + Intronic
1038220665 8:25604114-25604136 ACCTCTCCTCAAAGTAGCCTTGG + Intergenic
1039457955 8:37720569-37720591 TCCTTTCCTCCCAGGAGACCAGG + Intergenic
1047754056 8:127905077-127905099 AACTTTTCTCCAAGGAAGCCAGG - Intergenic
1048445986 8:134493707-134493729 ACCGTTCCTCCAAGGAGGGCCGG - Intronic
1048997218 8:139801467-139801489 ACCTGGCCCCCAAGGAGGCATGG + Intronic
1049045879 8:140151149-140151171 ACTTCTCCTCAAGGGGGGCCAGG + Intronic
1049176814 8:141197783-141197805 ACCTCACTGCCAAGGAGGCAGGG + Intergenic
1049270776 8:141694926-141694948 ACCTCTTCTCCAAGGAGCCCTGG - Intergenic
1049730013 8:144171858-144171880 CCCTCTTGTCCAAGGAGACCCGG + Intronic
1050310550 9:4348538-4348560 ACACCTACTCCAAGGAGGCTGGG + Intergenic
1052609904 9:30758911-30758933 ACATGTCCTCCACGGAGCCCAGG + Intergenic
1053415070 9:37942313-37942335 CCATCTCCTCCAAGGAGGGAAGG - Intronic
1054992145 9:71340827-71340849 ACCACTTCTACAAGGAGCCCTGG - Intronic
1055559498 9:77508712-77508734 GCCATTTCTCCAAGGAGGCCTGG - Intronic
1055980205 9:81993443-81993465 ACCTGTCGTCCAAGAAGGGCAGG + Exonic
1057262643 9:93594096-93594118 ACAGCTCCTTCAGGGAGGCCTGG - Intronic
1058149030 9:101443663-101443685 TTCTCCCCTCCAAGGAAGCCAGG - Intergenic
1060172488 9:121473433-121473455 ACCTTTCCTCCCTGGAGGCTTGG - Intergenic
1060733724 9:126053274-126053296 ACCTCTCATTCCAGGAGTCCCGG + Intergenic
1061077122 9:128348467-128348489 ACCTCTGCTCCCAGCAGGGCTGG - Intronic
1061444837 9:130631943-130631965 ACCTTTCCTCCAAGGAGCTCCGG + Exonic
1062112495 9:134789800-134789822 ACCGCTCCTGCAGGGAGGCCTGG - Intronic
1062210428 9:135360600-135360622 ACCTTCTCTCCCAGGAGGCCAGG - Intergenic
1062323656 9:136002700-136002722 GGCTCTCCTCCAAGGAGGGATGG - Intergenic
1062630424 9:137460834-137460856 CCCCCGCCTCCAAGGTGGCCCGG + Intronic
1186198019 X:7129469-7129491 ACATGTCCTCCATGGAGGTCAGG - Intronic
1186664376 X:11703252-11703274 ACCTCTGCTCCAGGAAGGGCAGG + Intergenic
1187023820 X:15411741-15411763 GCCTCTTGTCCTAGGAGGCCAGG - Intronic
1187804782 X:23107472-23107494 GCCACTTCTCCAAGGAGCCCTGG + Intergenic
1189780349 X:44508045-44508067 TTCTTTCCTCCAAGGAGGCTAGG - Intergenic
1193730091 X:85092445-85092467 ACCTTTCCTCTGAGGAGGGCTGG - Exonic
1200252407 X:154560539-154560561 ACTTCTCCTCCGAGGCGGCCTGG - Exonic
1200265360 X:154643877-154643899 ACTTCTCCTCCGAGGCGGCCTGG + Intergenic
1201571627 Y:15421539-15421561 ACGTGTCCTCCATGGATGCCAGG - Intergenic