ID: 915168693

View in Genome Browser
Species Human (GRCh38)
Location 1:153963100-153963122
Sequence CACCCACTCCGTTCGGGAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 91}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915168693_915168702 26 Left 915168693 1:153963100-153963122 CCAACTCCCGAACGGAGTGGGTG 0: 1
1: 0
2: 1
3: 4
4: 91
Right 915168702 1:153963149-153963171 AGATGTCTTGGGTAGCTTCGTGG 0: 1
1: 0
2: 1
3: 5
4: 67
915168693_915168701 15 Left 915168693 1:153963100-153963122 CCAACTCCCGAACGGAGTGGGTG 0: 1
1: 0
2: 1
3: 4
4: 91
Right 915168701 1:153963138-153963160 GGGCTGTGCAGAGATGTCTTGGG 0: 1
1: 0
2: 1
3: 26
4: 290
915168693_915168700 14 Left 915168693 1:153963100-153963122 CCAACTCCCGAACGGAGTGGGTG 0: 1
1: 0
2: 1
3: 4
4: 91
Right 915168700 1:153963137-153963159 AGGGCTGTGCAGAGATGTCTTGG 0: 1
1: 0
2: 3
3: 35
4: 328
915168693_915168697 -6 Left 915168693 1:153963100-153963122 CCAACTCCCGAACGGAGTGGGTG 0: 1
1: 0
2: 1
3: 4
4: 91
Right 915168697 1:153963117-153963139 TGGGTGAAGCCAAAAAGGCTAGG 0: 1
1: 0
2: 0
3: 14
4: 199
915168693_915168698 -5 Left 915168693 1:153963100-153963122 CCAACTCCCGAACGGAGTGGGTG 0: 1
1: 0
2: 1
3: 4
4: 91
Right 915168698 1:153963118-153963140 GGGTGAAGCCAAAAAGGCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 158
915168693_915168703 27 Left 915168693 1:153963100-153963122 CCAACTCCCGAACGGAGTGGGTG 0: 1
1: 0
2: 1
3: 4
4: 91
Right 915168703 1:153963150-153963172 GATGTCTTGGGTAGCTTCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915168693 Original CRISPR CACCCACTCCGTTCGGGAGT TGG (reversed) Exonic
901341263 1:8501014-8501036 CAGCCACCCCGTCCGGGAGGGGG + Intronic
901877760 1:12176631-12176653 CACACACTCCTATCAGGAGTTGG + Intronic
902050485 1:13560519-13560541 CACTCACTCCGTCCAGCAGTAGG - Intergenic
903686283 1:25134758-25134780 AACCCACTCCATTAGGGACTTGG - Intergenic
906427358 1:45725138-45725160 CAGCCGCCCCGTCCGGGAGTGGG + Intronic
906507800 1:46393129-46393151 CACTCACTCCGTCCAGCAGTAGG + Intergenic
906740139 1:48174424-48174446 CAGCCGCTCCGTCCGGGAGGTGG + Intergenic
908768153 1:67572516-67572538 CACCCACTCCTGTCCGGAGCCGG + Intergenic
915168693 1:153963100-153963122 CACCCACTCCGTTCGGGAGTTGG - Exonic
916037344 1:160933389-160933411 CAGCCACTCCGTCCGGGAGGTGG + Intergenic
916050112 1:161029849-161029871 CAGCCACCCCGTCCGGGAGGTGG + Intronic
922306487 1:224349810-224349832 CAGCCGCCCCGTTCGGGAGGTGG - Intergenic
922644930 1:227276473-227276495 CAGCCGCCCCGTTCGGGAGGTGG + Intronic
1069547411 10:69338560-69338582 CCCACACTCCATTTGGGAGTTGG - Intronic
1071538329 10:86455000-86455022 CAGCCACCCCGTCCGGGAGGTGG + Intronic
1073099169 10:100998073-100998095 CCTCCACTCCTTGCGGGAGTCGG + Intronic
1076011753 10:126994912-126994934 CAGCCACCCCGTTCGGGAGGTGG - Intronic
1077577758 11:3397474-3397496 CAGCCACCCCGTCCGGGAGGTGG + Intergenic
1082233690 11:49798305-49798327 CAGCCACCCCGTCCGGGAGGTGG - Intergenic
1088495876 11:110430532-110430554 CACCCACTCCCGGCGGGAATCGG + Intronic
1092184802 12:6470837-6470859 CAACCGCTCCTTTCCGGAGTCGG - Intronic
1093038522 12:14354837-14354859 CAGCCACCCCGTCCGGGAGGTGG + Intergenic
1096119722 12:49080347-49080369 AACACACTCCGTGTGGGAGTGGG + Intergenic
1098429931 12:70408094-70408116 CACCCCCACCGTTTGGGAATGGG - Intronic
1107493379 13:40901170-40901192 CAGCCACCCCGTCCGGGAGGTGG + Intergenic
1114578745 14:23736948-23736970 CAGCCGCCCCGTTCGGGAGATGG + Intergenic
1115210904 14:30966746-30966768 CACTCACTCCGTCCAGCAGTAGG - Intronic
1118517391 14:66545172-66545194 CAGCCGCTCCGTCCGGGAGGTGG - Intronic
1120170546 14:81244522-81244544 CAGCCACCCCGTCCGGGAGGTGG - Intergenic
1122233211 14:100317586-100317608 CACCCACTCCCTTCCAGAGTGGG + Intergenic
1122233212 14:100317588-100317610 CACCCACTCTGGAAGGGAGTGGG - Intergenic
1122568466 14:102677222-102677244 CAGCCACCCCGTCCGGGAGGGGG - Intronic
1122887132 14:104715079-104715101 CGCCACCTCCGTTAGGGAGTAGG + Intronic
1125862958 15:43015043-43015065 CAGCCACCCCGTCCGGGAGGTGG + Intronic
1128843677 15:70871545-70871567 CAGCCGCGCCGTTCGGGAGGTGG - Intronic
1129703919 15:77783845-77783867 GACCCACTCCAGCCGGGAGTGGG + Intronic
1129740830 15:77988823-77988845 CACCCACTGCGTGCAGGGGTGGG - Intronic
1129844894 15:78763717-78763739 CACCCACTGCGTGCAGGGGTGGG + Exonic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134235685 16:12463802-12463824 CACACACTCACTTCGGGAGGTGG - Intronic
1146666576 17:34709050-34709072 CACCCACTCTGGAGGGGAGTTGG - Intergenic
1147505143 17:41008836-41008858 ATCCCACTCAGTCCGGGAGTCGG + Exonic
1157455957 18:47828333-47828355 CATCCACCCCGTCCGGGAGGTGG + Exonic
1157857679 18:51117189-51117211 CAGCCACCCCGTCCGGGAGGTGG - Intergenic
1159806705 18:72965634-72965656 CATCCCCTCCGTTCGGGAGTGGG + Intergenic
1163927596 19:20360782-20360804 CACTCACTCCATTCAGCAGTAGG - Intergenic
1164046903 19:21551250-21551272 CAGCCACCCCGTCCGGGAGGTGG - Intronic
1164280268 19:23762849-23762871 CACCCGCCCCGCTCGGCAGTAGG - Intergenic
1166611722 19:44204173-44204195 CAGCCACCCCGTCCGGGAGGTGG + Intergenic
1171861439 20:30405509-30405531 CAGCCACCCCGTCCGGGAGGTGG + Intergenic
1175507560 20:59496531-59496553 CACCCACTCCGTGCTGGGGCTGG + Intergenic
1179654988 21:42839334-42839356 CACCCACCACGTTTGGGGGTTGG - Intergenic
1183515939 22:38266110-38266132 CACCCCCTCTGTTGGGGAGGGGG + Intronic
952260376 3:31734293-31734315 CACCAACTCCCTTCGGGGGAGGG + Intronic
952894010 3:38064647-38064669 CAGCCACCCCGTCCGGGAGGTGG - Intronic
954060404 3:48061860-48061882 CAGCCACCCCGTCCGGGAGGTGG + Intronic
954446747 3:50550902-50550924 CACCCAGTCGGTTCTGGACTTGG - Intergenic
954567020 3:51607936-51607958 CAGCCACCCCGTCCGGGAGGAGG - Intronic
962688862 3:137872928-137872950 CAGCCACCCCGTCCGGGAGGTGG + Intergenic
962937665 3:140095889-140095911 CACCCACACTGTTGGTGAGTGGG + Intronic
963111217 3:141689661-141689683 CATCCAATCCGTTAGGAAGTGGG - Intergenic
963244570 3:143047334-143047356 CAGCCACCCCGTCCGGGAGGGGG - Intronic
968852713 4:3094550-3094572 CACCCGCCCCGTCCGGGAGGTGG - Intronic
968852754 4:3094634-3094656 CACCCGCCCCGTCCGGGAGGTGG - Intronic
968852794 4:3094718-3094740 CAGCCGCTCCGTCCGGGAGGTGG - Intronic
970409374 4:15791276-15791298 CAGCCACCCCGTCCGGGAGGGGG + Intronic
971282052 4:25249489-25249511 CAGCCACCCCGTCCGGGAGGCGG - Intronic
971288743 4:25315373-25315395 CACACACTGCGTTCGGGACAGGG - Exonic
972784492 4:42314329-42314351 CACTCACTCCGTCCAGCAGTAGG - Intergenic
973337046 4:48967230-48967252 CACACACTCTGTTCTGCAGTTGG + Intergenic
975828129 4:78341002-78341024 CACCCACTCCCTTCTGTTGTGGG - Intronic
976265988 4:83186197-83186219 CAGCCACCCCGTCCGGGAGCGGG - Intergenic
985521974 5:377972-377994 CACCCACTCTGTTCTGGGGGAGG + Intronic
989247752 5:39273043-39273065 CAGCCACCCCGTCCGGGAGGTGG + Intronic
998939042 5:147260815-147260837 CACTCACTCCGTCCAGCAGTAGG + Intronic
999532580 5:152479873-152479895 CAGCCACCCCGTCCGGGAGGTGG - Intergenic
999987088 5:157014484-157014506 CAGCCACCCCGTCCGGGAGGTGG + Intergenic
1001394104 5:171403971-171403993 CAGCCACCCCGTCCGGGAGATGG - Intronic
1001558781 5:172655517-172655539 CACTCACTCCGTCCAGCAGTAGG + Intronic
1005865344 6:29932793-29932815 CACCCACTCCGGGAGGGAGTTGG + Intergenic
1005933155 6:30498748-30498770 CAGCCGCCCCGTTCGGGAGGTGG - Intergenic
1019651588 7:2161952-2161974 CAGCCACCCCGTCCGGGAGGTGG + Intronic
1024756526 7:52539779-52539801 GACCCATTCCATTCGGCAGTTGG + Intergenic
1030329431 7:108256026-108256048 CAGCCACCCCGTCCGGGAGGTGG + Intronic
1040722950 8:50348383-50348405 TACCCGCTCCTTTCTGGAGTTGG + Intronic
1042134063 8:65617023-65617045 CAGCCACCCCGTCCGGGAGGTGG + Intronic
1045235832 8:100351569-100351591 CAGCCGCCCCGTTCGGGAGGTGG + Intronic
1050616506 9:7406854-7406876 CACCCACTTCTTGCGGGAGAAGG + Intergenic
1052928758 9:34039212-34039234 CAGCCGCCCCGTTGGGGAGTTGG + Intronic
1056794660 9:89649431-89649453 CACACACTCCTTGGGGGAGTGGG + Intergenic
1187261830 X:17691927-17691949 CACCCACTGGGTACGGGAGCTGG - Intronic
1189825252 X:44911178-44911200 CAGCCACCCCGTCCGGGAGGTGG - Intronic
1191679307 X:63825428-63825450 CAGCCACCCCGTCCGGGAGGTGG - Intergenic
1191679328 X:63825470-63825492 CAGCCACCCCGTCCGGGAGGTGG - Intergenic
1195847278 X:109241812-109241834 CACTCACTCCGTCCAGCAGTAGG + Intergenic
1195889008 X:109671474-109671496 CAGCCACCCCGTCCGGGAGGTGG + Intronic
1201335792 Y:12878861-12878883 CACCCACTCCGGGAGGGAGGTGG + Intergenic