ID: 915170767

View in Genome Browser
Species Human (GRCh38)
Location 1:153975712-153975734
Sequence ATGGAATATCTGAAAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 444}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915170767_915170773 2 Left 915170767 1:153975712-153975734 CCCTCTTCTTTCAGATATTCCAT 0: 1
1: 0
2: 3
3: 36
4: 444
Right 915170773 1:153975737-153975759 TACCCCCAGACCAGGGGAAAAGG 0: 1
1: 0
2: 1
3: 16
4: 168
915170767_915170776 5 Left 915170767 1:153975712-153975734 CCCTCTTCTTTCAGATATTCCAT 0: 1
1: 0
2: 3
3: 36
4: 444
Right 915170776 1:153975740-153975762 CCCCAGACCAGGGGAAAAGGTGG 0: 1
1: 0
2: 1
3: 24
4: 280
915170767_915170781 28 Left 915170767 1:153975712-153975734 CCCTCTTCTTTCAGATATTCCAT 0: 1
1: 0
2: 3
3: 36
4: 444
Right 915170781 1:153975763-153975785 GACCATCCATCTAAAGTCATAGG 0: 1
1: 0
2: 0
3: 7
4: 69
915170767_915170769 -6 Left 915170767 1:153975712-153975734 CCCTCTTCTTTCAGATATTCCAT 0: 1
1: 0
2: 3
3: 36
4: 444
Right 915170769 1:153975729-153975751 TTCCATGCTACCCCCAGACCAGG 0: 1
1: 0
2: 1
3: 13
4: 171
915170767_915170778 6 Left 915170767 1:153975712-153975734 CCCTCTTCTTTCAGATATTCCAT 0: 1
1: 0
2: 3
3: 36
4: 444
Right 915170778 1:153975741-153975763 CCCAGACCAGGGGAAAAGGTGGG 0: 1
1: 0
2: 2
3: 25
4: 253
915170767_915170770 -5 Left 915170767 1:153975712-153975734 CCCTCTTCTTTCAGATATTCCAT 0: 1
1: 0
2: 3
3: 36
4: 444
Right 915170770 1:153975730-153975752 TCCATGCTACCCCCAGACCAGGG 0: 1
1: 0
2: 1
3: 16
4: 201
915170767_915170772 -4 Left 915170767 1:153975712-153975734 CCCTCTTCTTTCAGATATTCCAT 0: 1
1: 0
2: 3
3: 36
4: 444
Right 915170772 1:153975731-153975753 CCATGCTACCCCCAGACCAGGGG 0: 1
1: 0
2: 4
3: 18
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915170767 Original CRISPR ATGGAATATCTGAAAGAAGA GGG (reversed) Intronic
903144385 1:21361344-21361366 ATGGGATATCAGACAGGAGAAGG + Intergenic
904390822 1:30184640-30184662 ATGGACTAAAGGAAAGAAGATGG - Intergenic
905070729 1:35223103-35223125 CTGGAATATCTCAGAAAAGAGGG - Intergenic
906613195 1:47217665-47217687 ATGGCAAGTCTGAAAGAAGAGGG + Exonic
908556876 1:65265313-65265335 TTGGAATATCTGAAATAATTGGG + Intronic
909125521 1:71663631-71663653 AAAGACTATCAGAAAGAAGATGG - Intronic
909339141 1:74511996-74512018 AAGGAAAATCGGAAGGAAGAGGG + Intronic
909562183 1:77019245-77019267 ATAGAATATATGAAACAAAAAGG + Intronic
909570003 1:77098716-77098738 ATGGAATTTATGACAGAAAAGGG + Intronic
909938755 1:81586313-81586335 AAGGAATCTCTGCATGAAGAAGG - Intronic
909946980 1:81674805-81674827 AGGGAATATTTGAAAAGAGAGGG + Intronic
910796839 1:91105904-91105926 ATGCAATATCAGACAGAAGGTGG + Intergenic
910960286 1:92754984-92755006 ATGTTATATCTTAAAGAAGATGG + Intronic
911232125 1:95372648-95372670 ATTGAGTATCTGAAAGGAAAGGG + Intergenic
911382408 1:97131346-97131368 ACAGAATATCTGAAAGAGAATGG + Intronic
911860708 1:102944481-102944503 CTGGGATAACTGAAAGAGGATGG + Intronic
912235068 1:107842194-107842216 AAGCAATGTCTTAAAGAAGAGGG - Intronic
912301974 1:108526968-108526990 ATGGAATATCTGCCAGTAGTTGG - Intergenic
912667742 1:111598143-111598165 ATGGTATAGCAGAAAGAACAGGG - Intronic
912941029 1:114044915-114044937 ATGGAATATGGGAAAAATGATGG - Intergenic
912983005 1:114395607-114395629 ATGGATTTTGTGAAAAAAGAGGG + Exonic
913044806 1:115064821-115064843 CTGGAATATGTGAAAGAGGGAGG + Intronic
913073191 1:115319244-115319266 ATGGAGAATCTTGAAGAAGAAGG - Intronic
913130070 1:115830970-115830992 ATGGAATAACTGAAAATAAAAGG + Intergenic
913223132 1:116675408-116675430 ATGGAAGATCTGAGAGAAGAGGG + Intergenic
913374547 1:118136248-118136270 ATGGACCATCTGAATGAATATGG + Intronic
913397452 1:118387851-118387873 ATGAAAACTCTCAAAGAAGAGGG - Intergenic
913487797 1:119349378-119349400 TTGGAAAATCAGAAAGAAAAAGG + Intergenic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
915267471 1:154729241-154729263 TTGGCATATCTGAAAGCAAAAGG - Intronic
915271900 1:154759395-154759417 ATGGAAAAGCTGACAGAATATGG + Intronic
915683031 1:157600813-157600835 ATGGAAAAACTGAAAAAAGCTGG - Intergenic
915683039 1:157600934-157600956 ATGGAAAAACTGAAAAAAGCTGG - Intergenic
917251200 1:173062938-173062960 ATAGAATGTGTGAAAGATGATGG - Intergenic
917582239 1:176391044-176391066 ATGGAAGAACTGACAGAAGTAGG - Intergenic
918259149 1:182779009-182779031 ATGGAATATGAAATAGAAGATGG - Intergenic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
918761332 1:188414090-188414112 AAGGAATATTTGAAATAGGAAGG - Intergenic
921538031 1:216376479-216376501 AAAGAATATTTGAAAGAATAGGG - Intronic
921679683 1:218015763-218015785 CTGGAATTTCTTAAAGAAAATGG + Intergenic
921845892 1:219881587-219881609 ATGAAATATCTGACAGTAAAGGG + Intronic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
922425517 1:225488971-225488993 ATGGAAGATATAAAATAAGAAGG + Exonic
924948985 1:248865508-248865530 ATAAAATATCTGAGGGAAGAGGG - Intergenic
1063733086 10:8721769-8721791 ATGGATTTCCTGAAAGAAGCTGG + Intergenic
1063852036 10:10203053-10203075 GTGGAATATCTTAAAAAAGAAGG - Intergenic
1064061918 10:12145084-12145106 GTGGAAGAAATGAAAGAAGAGGG + Intronic
1064621895 10:17225807-17225829 ATGGAATGTTAGAAAGAAGAAGG - Intergenic
1064807103 10:19147829-19147851 AAGGAATTACTGAGAGAAGACGG + Intronic
1064859403 10:19811164-19811186 ATGGAATATTGGAAATAAAAAGG + Intergenic
1064895513 10:20231671-20231693 ATTTAATATCTCTAAGAAGATGG + Intronic
1067415533 10:46098895-46098917 ATGGCAGATCTGAAAGGAGATGG + Intergenic
1067606353 10:47666991-47667013 ATGGGAAATTTGAAAGAAAATGG - Intergenic
1068597613 10:58920017-58920039 ATTGCTTCTCTGAAAGAAGACGG + Intergenic
1068729704 10:60343298-60343320 ATGGTTTATCTGAAAGAGGAAGG + Intronic
1068740864 10:60468410-60468432 ATCAAATTTCTGAAAGAAAAAGG + Intronic
1068854511 10:61783871-61783893 ATGGAATGTTAAAAAGAAGATGG + Intergenic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069130833 10:64700213-64700235 ATGTAATATGTGAGACAAGATGG + Intergenic
1069189870 10:65473679-65473701 CTGGAATATTTGGAGGAAGAAGG - Intergenic
1070429622 10:76324170-76324192 ATGGAATAGCTCTAAGAAAAGGG - Intronic
1070467925 10:76743422-76743444 ATAGAACAGCTAAAAGAAGAAGG - Intergenic
1071621913 10:87128344-87128366 ATGGGAAATTTGAAAGAAAATGG - Intronic
1071666158 10:87560771-87560793 ATAGGGTATATGAAAGAAGAAGG + Intergenic
1071755329 10:88531678-88531700 AGGGAATTTCTGGCAGAAGATGG - Intronic
1071850719 10:89567141-89567163 ATAGAATAGCTGAAAGAGGGTGG + Intergenic
1073637893 10:105218450-105218472 ATGGAAACTCTGTAAGAGGAGGG - Intronic
1073668428 10:105560076-105560098 AAGAAATAAATGAAAGAAGAAGG - Intergenic
1073899267 10:108201037-108201059 ATGGCATAGCAGAAAGAACATGG - Intergenic
1075162366 10:120035458-120035480 AGGGAATATCCCAAAGAAAAGGG + Intergenic
1075266971 10:121009225-121009247 GTGAAAAGTCTGAAAGAAGATGG - Intergenic
1076078202 10:127554447-127554469 ATGGAATATCTGCTGAAAGAAGG - Intergenic
1077788057 11:5406132-5406154 ATGCAATCTCAGAAAGAAAATGG - Intronic
1078246596 11:9578541-9578563 ATGCAATACCTGAAAAATGAAGG - Intronic
1078427775 11:11265587-11265609 GTGGAATATCTGACAGCAGATGG + Intergenic
1078797847 11:14611143-14611165 GTGGAATACCTGAAAGACAATGG + Exonic
1079006115 11:16792248-16792270 ATGGAATGTCTGGAGGCAGAGGG + Intronic
1079288460 11:19162908-19162930 TTGGAATCTCTGAATCAAGAGGG + Intronic
1079310451 11:19360923-19360945 ATGGAATATACCAGAGAAGATGG + Intronic
1079757087 11:24278149-24278171 TTGGCATTTCTGACAGAAGAAGG + Intergenic
1080043971 11:27789090-27789112 ATGGAATAGGTGAGAGAAAATGG - Intergenic
1080080286 11:28208959-28208981 ATGGAATTTATGAAACTAGAAGG - Intronic
1080148720 11:29022441-29022463 GGGGAATATCTGGAAGGAGAAGG + Intergenic
1080278581 11:30530662-30530684 AGGGAAAATCAGAAATAAGAAGG + Intronic
1080596385 11:33777375-33777397 ATGGTAGATCAGAAAGCAGAAGG + Intergenic
1080737343 11:35029562-35029584 ATGAAATATATGAAAGTACATGG - Intergenic
1081025641 11:38010494-38010516 ATGGAATATTTCACAGAAGCTGG + Intergenic
1081284910 11:41256002-41256024 TTGGAGTATCTGTAACAAGAAGG + Intronic
1081308421 11:41541557-41541579 ATGGATTATCTAACTGAAGATGG + Intergenic
1081825769 11:46049975-46049997 ATGAAATATATGATAGAATATGG - Intronic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1083638341 11:64132306-64132328 CTGGAATATCTGAAAACAGGTGG - Intronic
1084647870 11:70470692-70470714 ATGGAAAAACTGAAAGCACACGG + Intronic
1085335039 11:75687122-75687144 ATGGATTAACTGACAGAAGTAGG - Intergenic
1085956022 11:81396025-81396047 AAGGAAAATCTGAAAGCTGAAGG + Intergenic
1086163750 11:83752788-83752810 CTGGAATATGAGAACGAAGAAGG + Intronic
1086188202 11:84045257-84045279 TTGGATTATCAGAAATAAGATGG - Intronic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1086834759 11:91607086-91607108 ATGGAAGAATTGAAAGATGAGGG - Intergenic
1086901699 11:92374796-92374818 ATGGAATTTCAGAAGGAAGATGG - Intronic
1086924816 11:92628835-92628857 CTGGATCTTCTGAAAGAAGAAGG + Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087250863 11:95898053-95898075 ATGTAGTATTTGAAAGAAAAAGG - Intronic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087729093 11:101758282-101758304 ATGGAATAACTGAGAGGTGAGGG - Intronic
1089130111 11:116205591-116205613 GGGGAAAATCTGAAAGAAGGTGG - Intergenic
1089528685 11:119112973-119112995 ATGGAATGTCTGAAAACAGGGGG - Intronic
1090427486 11:126618720-126618742 ATGAAATATCTGAAACTAGGTGG - Intronic
1090896693 11:130983166-130983188 ATAGAAAATGTGAAATAAGATGG + Intergenic
1092832989 12:12463292-12463314 ATGGACTATCTGGAAAAGGATGG - Intronic
1093004173 12:14034165-14034187 ATGGCATATCTGGAAGATCATGG + Intergenic
1093544313 12:20328391-20328413 ATGGAAAATATAAAATAAGATGG + Intergenic
1093854572 12:24085053-24085075 AAGGACTACCTGAAAAAAGAGGG + Intergenic
1094623725 12:32103946-32103968 ATGGCATATACGAAAAAAGAGGG + Intergenic
1097712243 12:62929735-62929757 ATGCTATATCTGAAATATGAAGG + Intronic
1098622957 12:72627066-72627088 ATGGAATAGCAAAAAGAACAGGG + Intronic
1098837414 12:75439445-75439467 TTGGAAGATCAGAAATAAGAGGG - Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099207060 12:79740937-79740959 ATGGAACTTCTTAAAGAATAAGG + Intergenic
1101593372 12:106141519-106141541 ATGGCATATATGAAAGGAGAAGG - Intergenic
1102733833 12:115139595-115139617 TTGAAATATCTAAGAGAAGATGG - Intergenic
1102901179 12:116638508-116638530 ATGGTATATGAGAAAGAGGAGGG + Intergenic
1105824809 13:24112765-24112787 ATGGAAGGTCTTACAGAAGAAGG - Intronic
1106656759 13:31754810-31754832 ATGGAATAACATAAAGAAGTAGG + Intronic
1107306533 13:39026388-39026410 CTGTAATATAAGAAAGAAGAGGG + Intronic
1107733192 13:43369236-43369258 ATGGAAGGACTGAAGGAAGAGGG - Intronic
1107812961 13:44217708-44217730 ATTGACTTTATGAAAGAAGAAGG - Intergenic
1107897114 13:44976269-44976291 ATGCAAAAAATGAAAGAAGAAGG + Intronic
1108394262 13:49978065-49978087 ATGGTTTCTCTGAAACAAGAAGG - Intergenic
1108931188 13:55822600-55822622 TTGGTGTTTCTGAAAGAAGAAGG + Intergenic
1109262133 13:60157395-60157417 ATACAACATCTGAAAGAAAAAGG - Intronic
1109378939 13:61532940-61532962 ATTGAATATCTGAAATAACTTGG + Intergenic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1110962447 13:81645203-81645225 ATTGTATATCTCAAAGAATAGGG - Intergenic
1114708961 14:24757864-24757886 CAAGCATATCTGAAAGAAGAGGG - Intergenic
1114854159 14:26417417-26417439 ATGGCACATCTGAAAGAGCAAGG - Intergenic
1115067252 14:29278931-29278953 ATGTAATGTGTGGAAGAAGAAGG + Intergenic
1115191594 14:30752776-30752798 CTGGAATATTTGAAAGGAGTTGG - Intergenic
1115419861 14:33182162-33182184 ATGGAATCTTTTAAAGAAGATGG + Intronic
1115756542 14:36532371-36532393 AAAGAATATCTGAAAGATTAAGG + Intergenic
1116641378 14:47467923-47467945 ATGAAATGTCTGTATGAAGATGG + Intronic
1116894404 14:50301870-50301892 AGGGAATAACTAAAAAAAGATGG - Intronic
1116911486 14:50470564-50470586 TTGGAATATATGAAAAAATATGG + Intronic
1118350252 14:64968587-64968609 ATGAGATATCTGAAAGAACTTGG - Intronic
1119202401 14:72766315-72766337 AAGAAATAACTGAAAGATGAAGG + Intronic
1120325678 14:83022369-83022391 ATGAAATATATGAGAGATGATGG - Intergenic
1124052296 15:26208539-26208561 ATTGAAAATCTTAAAGATGATGG + Intergenic
1126002608 15:44225310-44225332 ATAGAATATGTGAAAGAGTATGG + Intergenic
1128007371 15:64256059-64256081 GTGGAATATCTGCAACCAGATGG - Intronic
1128378817 15:67096242-67096264 AAGGAAGATCTGAAAGGAAAAGG - Intronic
1129096335 15:73212396-73212418 CTATAATATATGAAAGAAGAAGG - Intronic
1129430211 15:75495167-75495189 ATAGAATAAAAGAAAGAAGATGG + Intronic
1130040183 15:80399894-80399916 ATGGAATAGCCAAAAGCAGAGGG - Intronic
1130252491 15:82309074-82309096 ATGGAAAGACTGAAAGGAGAAGG + Intergenic
1130534273 15:84772101-84772123 ATGGTATAGCTAAAAGAATAAGG - Intronic
1130710481 15:86275903-86275925 ATGAAGAATCTGAAAGAAGTTGG - Intronic
1131937771 15:97525742-97525764 ATGGAAAAAAGGAAAGAAGAAGG + Intergenic
1132917483 16:2359645-2359667 AGGAAATATCTGAAAGTAGTAGG + Intergenic
1133492779 16:6286866-6286888 ATGCAACATCTGTAAGAACAAGG + Intronic
1134287294 16:12873170-12873192 ATGGTCTATCTGAATTAAGAAGG + Intergenic
1138618015 16:58187219-58187241 ATGGAAAAACTGAAACAAAATGG + Intronic
1139155880 16:64441713-64441735 ATGCAATATCGCAAAGGAGACGG + Intergenic
1139159872 16:64491552-64491574 AATGAATAACTGGAAGAAGACGG - Intergenic
1139213001 16:65099242-65099264 ATGGAATATTTAAAAAAACAGGG + Intronic
1139516417 16:67454920-67454942 AGGAAAGATCTGAAGGAAGAGGG - Intronic
1140141288 16:72260448-72260470 ATGGAATAACTGATGGAACAGGG + Intergenic
1140340259 16:74151971-74151993 ATAGAAAACCTGAAATAAGATGG - Intergenic
1140563287 16:76009488-76009510 ATAGAATAAATGAAAGAATAGGG + Intergenic
1140959820 16:79900925-79900947 CTGCAATAGCTGAAAGAACATGG - Intergenic
1141376895 16:83539547-83539569 AGGGAAAATCTGACAGGAGAAGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143343849 17:6234976-6234998 ATGTAATATCTGTAAAAAAATGG + Intergenic
1145076761 17:19861881-19861903 ATGGAATATGTGAATGCAGTGGG - Intronic
1146266416 17:31456015-31456037 ATGGAAAATCTAAAGGAATAGGG - Intronic
1147705064 17:42420737-42420759 ATGGAGATTCTGAGAGAAGAGGG - Intronic
1148033960 17:44643845-44643867 AGGGAATATATGAAAGCTGATGG + Intergenic
1148974253 17:51512918-51512940 ATGAATTATCTTAAAGATGAGGG - Intergenic
1149187996 17:54024340-54024362 ATGGATTATCTAAAATAAGCAGG + Intergenic
1150361367 17:64537589-64537611 ATGTAATGTCTGAAAAAAGAAGG - Exonic
1153510387 18:5845634-5845656 AGGAAGTATCTGAAAGATGATGG - Intergenic
1153732684 18:8030172-8030194 ATGGACTATGTGAATAAAGATGG - Intronic
1155723829 18:29053842-29053864 ATCACATATCTGAAAGAAAAAGG + Intergenic
1155794635 18:30020908-30020930 GTGTAAGATCTGAAAGAACAAGG + Intergenic
1156582036 18:38388573-38388595 CAGGAAAATCTGAAAGGAGAAGG - Intergenic
1157016433 18:43720236-43720258 ATGGATTAACTGACAGAAGTAGG + Intergenic
1157021749 18:43791423-43791445 ATGAAATATCAGGAAGGAGAGGG + Intergenic
1157954206 18:52078026-52078048 ATTGATTATTTGAAAAAAGATGG - Intergenic
1158170268 18:54590687-54590709 ATTGAAAATCTTTAAGAAGAGGG - Intronic
1158193612 18:54859433-54859455 ATGAAATATTTGAAAGTGGATGG - Intronic
1158222350 18:55162684-55162706 ATGGAACATGTGAAAGAATGGGG + Intergenic
1158329046 18:56341233-56341255 AAGGTATAATTGAAAGAAGATGG + Intergenic
1158332104 18:56374421-56374443 ATGAAACTTCTGAAAGCAGAGGG - Intergenic
1158499622 18:57988425-57988447 ATGGTATAGCTGGAAGAAGCTGG - Intergenic
1159044566 18:63356780-63356802 CTGTAATATCTGATAGACGAAGG - Intronic
1159185253 18:64963173-64963195 ATGGAAAAGTTGAAAGAATAAGG - Intergenic
1159192114 18:65059883-65059905 GTGTAATAACTGAAAGAAAAGGG - Intergenic
1159266694 18:66089520-66089542 ATGGAATTGCTGAAAGTGGAAGG + Intergenic
1160068850 18:75606710-75606732 TTGAAATATCTGAAAGAATTTGG - Intergenic
1162686443 19:12388903-12388925 ATGGAATACCTCAAAGAGAAGGG + Intronic
1162690763 19:12428412-12428434 ATGGAATACCTCAAAGAGAAGGG + Intronic
1164073518 19:21791454-21791476 ATGGGATATCAGAAAGGAAAAGG - Intergenic
1164341941 19:24410903-24410925 TTTGAAGAGCTGAAAGAAGAAGG - Intergenic
1164976490 19:32576691-32576713 ATGGAAGACATGAAAGAAAAGGG + Intergenic
1166612935 19:44215683-44215705 AAAAAAAATCTGAAAGAAGATGG + Intronic
1166691658 19:44825183-44825205 ATGAAATATCAGAAAGAGGCAGG + Intergenic
1167777416 19:51568380-51568402 ATGAGATATATGAAAGAAAAGGG + Intergenic
1168340349 19:55619536-55619558 ATGGAACTTCTGAAAGAAACTGG + Intergenic
925035752 2:684267-684289 GTGGAATATCAAAAAGAAAATGG + Intergenic
925054435 2:846294-846316 GTGGAATATCTGAAACCAGAAGG + Intergenic
925445986 2:3927392-3927414 ACGTAATATCTGAAAAAAAATGG - Intergenic
925685233 2:6464504-6464526 ATTGAAGAGCTGAAAGGAGATGG + Intergenic
926174645 2:10579817-10579839 ATGGAACCACTGAGAGAAGATGG + Intronic
927239155 2:20904883-20904905 TTGCCATATCTGAAAGAAGAGGG + Intergenic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
929325727 2:40608702-40608724 AAGAGATTTCTGAAAGAAGAAGG + Intronic
929618178 2:43328678-43328700 ATGTAATCTGTGAAAGCAGAGGG + Intronic
930506798 2:52292728-52292750 ATGAAATGTCTGAACCAAGAGGG + Intergenic
931100895 2:58999785-58999807 TTGGAATGTCTGAAAGAACAAGG - Intergenic
931746803 2:65298174-65298196 ATGGAATATCCCAAAGCCGAGGG - Intergenic
932347986 2:71007998-71008020 GTTGAATATCTGAAAGAGGAGGG - Intergenic
933127426 2:78626690-78626712 CTGGATTAATTGAAAGAAGATGG + Intergenic
933140294 2:78783821-78783843 ATAGAAATTCTGAAAGGAGAAGG + Intergenic
934923548 2:98365888-98365910 ATGGATTAACTGACAGAAGTAGG - Intronic
935364983 2:102279706-102279728 ATGGAATCTGTGAATAAAGAGGG - Intergenic
935376038 2:102398943-102398965 ATGGAAGGTGTGAAACAAGAAGG - Intergenic
935895040 2:107726715-107726737 ATAGAAAATCCGAAGGAAGAAGG + Intergenic
936488432 2:112947440-112947462 ATTTAATAAGTGAAAGAAGAAGG - Intergenic
937469086 2:122159819-122159841 ATGAAATATCTGTAATAAGGTGG + Intergenic
937957971 2:127433045-127433067 ATGGAAACTGTGAAATAAGATGG + Intergenic
937998636 2:127714346-127714368 ATGAAATGCCTGAAAGAATAGGG - Intronic
938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG + Intronic
938637217 2:133241703-133241725 CTGGGATATGTGAAAGAAGGAGG - Intronic
938744226 2:134261710-134261732 ATGTAAGTTCTGAAAGAGGAGGG + Intronic
938852561 2:135275915-135275937 AAGGAAAATGTAAAAGAAGAGGG + Intronic
939251997 2:139693366-139693388 AGGGAAGATCTGAAAGAGTATGG - Intergenic
939293623 2:140226504-140226526 ATTGAATGTCTGAAAGCAGTGGG + Intergenic
939589645 2:144048355-144048377 GGTGAATATCTGAAAGAAAAAGG - Intronic
940297851 2:152147190-152147212 ATTAAATCTATGAAAGAAGAAGG - Exonic
941380150 2:164782977-164782999 ATGTAATATATGAAAAAAAATGG - Intronic
941762545 2:169260927-169260949 AAAGAATATTTGAGAGAAGATGG + Intronic
943200926 2:184822820-184822842 TTTGAATATCTGAAATAAAATGG - Intronic
944265386 2:197719111-197719133 ATGGAATAGCTGGAATAAAATGG + Intronic
944476058 2:200107873-200107895 ATGGAATATGCTAAAGAAGCTGG - Intergenic
944776982 2:202976647-202976669 ATGCAGTATCTGAAAAAATATGG + Intronic
945060609 2:205905616-205905638 GTGGGATATTTGAAAGAAGAGGG - Intergenic
945167656 2:206963003-206963025 ATGGCATATCTAAAATAACATGG + Intronic
945504569 2:210623023-210623045 AGTGATTATCTTAAAGAAGATGG + Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
945785697 2:214233828-214233850 ATGAAATATGTAAAAGTAGATGG - Intronic
945788922 2:214278686-214278708 AGGGAATAATTGAAAGATGAAGG - Intronic
945914848 2:215692622-215692644 AAGAAATATTTGAATGAAGAAGG - Intergenic
946914461 2:224503249-224503271 TTGGAATCTCTGAAAGAATCTGG - Intronic
947474643 2:230431761-230431783 ATGGAAAATGTGAAAAAAGAAGG - Intronic
948277965 2:236724649-236724671 GAGGAATATCTGAAGGAAGATGG - Intergenic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
1168927440 20:1594455-1594477 TTGGAATATTTGAAAGAACGGGG + Intronic
1169026281 20:2374335-2374357 ATGGAAGAAATGAATGAAGAGGG + Intergenic
1169279004 20:4251293-4251315 ATAGAATGCCTGGAAGAAGACGG + Intergenic
1170390386 20:15866701-15866723 ATGGCATCTCTGAAAAATGATGG - Intronic
1170530909 20:17290607-17290629 ATGGAATATCAGACAGAACTAGG - Intronic
1172457590 20:35090202-35090224 AAGAAATATTTGAAAGATGAAGG + Intronic
1173583472 20:44163927-44163949 ATGGAATATCAGCAATAAAAGGG + Intronic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1174435048 20:50500176-50500198 TTGGAATAACTGAAAGTGGAGGG - Intergenic
1174709947 20:52693822-52693844 ATGAAAACTCTGGAAGAAGAAGG + Intergenic
1175706955 20:61186418-61186440 TTGGAATGTCTGGAAGCAGATGG - Intergenic
1176359960 21:5986886-5986908 CACGAAGATCTGAAAGAAGAGGG + Intergenic
1177411032 21:20730904-20730926 AAGGCAGATCTGAAAGATGAAGG + Intergenic
1177500306 21:21946384-21946406 ATGGCACATCAGAAAGAAAATGG - Intergenic
1177738243 21:25119909-25119931 ATGGAATATGTGGAAGAATGGGG - Intergenic
1178021556 21:28414296-28414318 ATGGTATATCTGAAAAATGCTGG - Intergenic
1178323937 21:31628187-31628209 AAGGACTTTCAGAAAGAAGAGGG - Intergenic
1179763558 21:43551664-43551686 CACGAAGATCTGAAAGAAGAGGG - Intronic
1181947362 22:26528671-26528693 TTGGAATCTCTGAAGGAATAAGG + Intronic
1183257326 22:36770911-36770933 ATGGGAGTTCTGGAAGAAGAAGG + Intronic
1183442791 22:37832736-37832758 ATGGATGATCTGGAACAAGAGGG + Exonic
1185064460 22:48624004-48624026 ATGGGATCTCAGAAAGAAAAAGG - Intronic
949908006 3:8874744-8874766 ATAGAAAATATGAAATAAGATGG - Intronic
950792754 3:15486552-15486574 ATGGAATATAGAAAAGAAAAGGG - Intronic
951330042 3:21355986-21356008 AAGGTATATCAGAGAGAAGATGG + Intergenic
952198954 3:31105296-31105318 ATAGAATATCTGTAAGAACAAGG - Intergenic
954545114 3:51427483-51427505 ATGGAATTTTTGATAGAATATGG - Exonic
956245555 3:67178425-67178447 TTGCAATATCTGAAAGTATATGG + Intergenic
956403263 3:68902341-68902363 AGGTATTATCTGAAAGAAAATGG - Intronic
956497876 3:69848375-69848397 ATGGAATATTTTAAAGAGCAAGG + Intronic
956982828 3:74658757-74658779 ATGGGGTATCTGATAGAAAAAGG - Intergenic
957482135 3:80811924-80811946 ATGAATAATCTGAGAGAAGAAGG - Intergenic
957960065 3:87237516-87237538 ATGAAATATCGCAAAGTAGATGG - Intronic
958061429 3:88486967-88486989 ATGGAATAAATGGAAGAAAAGGG + Intergenic
958159037 3:89792431-89792453 ATGGAAAATGTTAAACAAGAAGG + Intergenic
959033546 3:101332966-101332988 ATGATATATCTTAAAGAAGATGG - Intronic
960194468 3:114748236-114748258 AGGGACTATTTGAAAAAAGATGG + Intronic
960365595 3:116767785-116767807 ATGGTATTTCTGACAGAAAATGG + Intronic
961074570 3:123969894-123969916 ATGGATGATCTGAAAGAAAACGG - Intronic
961429380 3:126870445-126870467 AAGGAATACCTGAAAGAACTGGG - Intronic
963695058 3:148556303-148556325 ATGGAATATTAGGAAGAAAAAGG - Intergenic
964079721 3:152739144-152739166 TTAGAATGTCTGAAAGAAAAGGG - Intergenic
964573170 3:158134043-158134065 ATTGAATATGAGAAAGAAAATGG + Intronic
965298580 3:166979950-166979972 ATGGAATAAATGAATGAATAAGG + Intergenic
965905847 3:173705039-173705061 ATTGTAGATCTGAATGAAGATGG - Intronic
966703395 3:182882203-182882225 ATTAATTATCTGAAAGAGGAAGG - Intronic
967597832 3:191348623-191348645 ATGGCATATTGGAAAGAACAGGG + Intronic
967653972 3:192023419-192023441 ATGGAATATAAGAAAAAACAAGG + Intergenic
969233216 4:5846433-5846455 AGGGATTATCTGGAAGAAGTGGG + Intronic
969711738 4:8848661-8848683 AAGGCATATCTGAAAAAAGGGGG - Intronic
970261367 4:14228384-14228406 AATGGATATTTGAAAGAAGATGG + Intergenic
970265261 4:14276021-14276043 ATGGAATATCAGCGAGATGAAGG - Intergenic
971025178 4:22582450-22582472 ATGGCAAATCTAAAAGAAGTTGG + Intergenic
971135319 4:23862371-23862393 TTGGAAAATTTGAAAGAAGCTGG + Intronic
971918920 4:32911040-32911062 TTGGAATATCTGAAACAAATGGG + Intergenic
972067829 4:34973309-34973331 ATGGCATATCTGATAGAATTTGG + Intergenic
973562267 4:52149095-52149117 ATGAAATATCTGTAAAAAGATGG + Intergenic
974497564 4:62651936-62651958 ATCGAATATCTTAAAACAGAAGG - Intergenic
976041620 4:80892118-80892140 CTGTAATAACTGAAAGAACATGG + Intronic
976071194 4:81241658-81241680 CTGGGATATCTGAAAGAATTGGG - Intergenic
976486520 4:85611872-85611894 ATTAAATATCTGAATGAAGAAGG - Intronic
976681874 4:87766340-87766362 ATGGAAGTTCTTTAAGAAGAGGG - Intergenic
977109388 4:92933896-92933918 GAGGAATATCTGAAAGTAGAAGG + Intronic
978354263 4:107854241-107854263 TGGGACTATCTGAAGGAAGACGG + Intronic
978453136 4:108858819-108858841 ATGGAAAAAATGAAAGTAGAAGG + Intronic
978905920 4:114005357-114005379 ATGGAATATCTGAATGAATGAGG + Intergenic
979801641 4:124916691-124916713 AAGGAATTTCTTCAAGAAGAAGG - Intergenic
979803683 4:124943857-124943879 ATTTAATATTTGAAAAAAGATGG + Intergenic
980155209 4:129096230-129096252 AAGGAATGTCAGAGAGAAGAGGG - Intronic
981032923 4:140143991-140144013 TTTGAAAATATGAAAGAAGATGG - Intronic
983402491 4:167282554-167282576 AAGGAAAAACTGAAAGAAGGAGG + Intergenic
983925422 4:173396077-173396099 ATGGGATATATGAAGCAAGAGGG + Intronic
984342327 4:178472707-178472729 ATGCAATGTCTACAAGAAGAAGG + Intergenic
986071258 5:4286961-4286983 ATGGAAAACAGGAAAGAAGAGGG - Intergenic
987086442 5:14474000-14474022 ATGGCACTTATGAAAGAAGATGG + Exonic
987725941 5:21699671-21699693 ATGGCACATGTGAAGGAAGAAGG - Intergenic
987731643 5:21781079-21781101 AGGGCAGATATGAAAGAAGACGG + Intronic
987915761 5:24211761-24211783 ATTGAATAACAGAAAGCAGAAGG - Intergenic
988443176 5:31255366-31255388 TTTAAATATGTGAAAGAAGAAGG - Intronic
988820848 5:34883370-34883392 ATGAAACTTCTGAAAGAAAATGG + Intronic
989658446 5:43771209-43771231 GTGGAATATATCACAGAAGATGG - Intergenic
990133886 5:52621325-52621347 ATGTAATATCTGGAAAAACATGG - Intergenic
991213663 5:64135766-64135788 AGGGTATTTCTGAAAGAAGTTGG - Intergenic
991348861 5:65700033-65700055 ATAGAATCTATGAAAAAAGAGGG + Intronic
992136636 5:73752702-73752724 CAGGAGTAACTGAAAGAAGATGG + Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
992648088 5:78830930-78830952 ATGGAATATCTGAAATCTGCTGG - Intronic
993154287 5:84202644-84202666 AGGGAATATTTGAGAGCAGAGGG + Intronic
993431277 5:87834670-87834692 AAGGGAAACCTGAAAGAAGAGGG + Intergenic
993826440 5:92692990-92693012 ATGCAATAGAGGAAAGAAGAAGG + Intergenic
993918836 5:93774540-93774562 ATGTAAGAACTGAAACAAGAAGG - Intronic
994192393 5:96882869-96882891 ATAGAATAGCTCAAATAAGAGGG - Intronic
995156177 5:108915919-108915941 ATGGGAAAAGTGAAAGAAGAGGG - Intronic
996004466 5:118404525-118404547 ATGGATAAACTGAAAGAAGTGGG - Intergenic
996269581 5:121586983-121587005 ATGGAACTTCTGAAAGAACCAGG - Intergenic
996454470 5:123664071-123664093 AAGGACTATCTGAAAGGTGATGG - Intergenic
998608600 5:143663402-143663424 ATGGATTAGCTTAAAGAAAATGG - Intergenic
999168667 5:149574047-149574069 ATGAAATATCTGAGTGAAAATGG + Intronic
999283069 5:150377451-150377473 CTGGAAGAGCTGAGAGAAGATGG + Intronic
999866300 5:155703874-155703896 ATGGAATCTCTACAAGAGGACGG + Intergenic
999896969 5:156045036-156045058 ATGGAATAACTGTAGCAAGAAGG - Intronic
999929104 5:156411250-156411272 ATGGAACATCTTGAAGAAAAAGG - Intronic
1000497717 5:162006439-162006461 TTGGAATAGCTGAAGGAAAATGG + Intergenic
1001459660 5:171899916-171899938 AAGGACTTTCAGAAAGAAGAGGG - Exonic
1002957140 6:1877263-1877285 ATGGAAGACTTGACAGAAGAAGG - Intronic
1003821866 6:9907061-9907083 AAGGAACTTCAGAAAGAAGAGGG + Intronic
1005434947 6:25799357-25799379 ATGGAAAATATGAAATAATATGG - Intronic
1005807985 6:29493032-29493054 ATGGACTATCTTAAGGAAAACGG + Intergenic
1007250783 6:40493467-40493489 ATGGAAGATGTGAAGGCAGAGGG - Intronic
1007323927 6:41046080-41046102 CTGGAACAACTGAAAAAAGAAGG + Intronic
1010002665 6:70963300-70963322 ATGAAATATGTGAAATATGATGG + Intergenic
1010170405 6:72968516-72968538 ATTGATTATTTGAAAGAGGAAGG + Intronic
1010619564 6:78057450-78057472 ATGGGACATAGGAAAGAAGAGGG + Intergenic
1011108294 6:83807472-83807494 ATGGAATATGTGAATGAAATGGG - Intergenic
1011182215 6:84633753-84633775 GGGGAACATTTGAAAGAAGATGG + Intergenic
1011221819 6:85062757-85062779 ATGGAAGAGCCGAAAGGAGAAGG + Intergenic
1011268141 6:85547147-85547169 ATGAACTTTCTGAAACAAGAAGG - Exonic
1012051552 6:94351498-94351520 CTGGAATAGCTCAAAGATGATGG + Intergenic
1012269878 6:97195430-97195452 AAGGAATATATAAAAGAACAAGG + Intronic
1012310268 6:97715200-97715222 ATGCAGTATCTTAAAGATGAGGG + Intergenic
1013309261 6:108878562-108878584 ATGGAATATCTGAATATGGATGG + Intronic
1014919817 6:127200700-127200722 ATTGAATGTCTGAAAGTAGCTGG - Intergenic
1016993406 6:149944715-149944737 ATGGAAAATCTGAAAGTCTAAGG - Intronic
1017004926 6:150022815-150022837 ATGGAAAATCTGAAAGTCTAAGG + Intronic
1017709776 6:157157096-157157118 GGGGAATATCCGAATGAAGAGGG - Intronic
1018237219 6:161738344-161738366 ATGGAAGATTTTAAAGATGACGG - Intronic
1020494665 7:8834375-8834397 AAGGAATAGTTGAATGAAGAGGG + Intergenic
1020669745 7:11091940-11091962 ATGGAACACCTGAAAGAATTAGG + Intronic
1021096057 7:16537470-16537492 ATGGAATTTCTGAAATAAGCAGG + Intronic
1021262101 7:18471129-18471151 ATGGAAATGCTGAAAGAACAAGG + Intronic
1022264495 7:28740801-28740823 ATGAATTATTTGAAAGAAAAAGG + Intronic
1023271764 7:38470571-38470593 ATGGAATGTGCAAAAGAAGAGGG - Intronic
1024034255 7:45494446-45494468 ATGGATGAGCTGACAGAAGAAGG - Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024916514 7:54506102-54506124 ATGGAAGAGCTAAAACAAGAAGG + Intergenic
1027807820 7:82852024-82852046 ATGGAAGAAAGGAAAGAAGAAGG + Intronic
1028554189 7:92104706-92104728 ATGGAATATCAGAAGCAAGGAGG - Intronic
1028682250 7:93549378-93549400 AAGGGATATCTGATAGAAAAGGG + Intronic
1028760251 7:94487960-94487982 ATGGGATATCTCAAAAAACATGG + Intergenic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1030238148 7:107290137-107290159 ATGTTACATGTGAAAGAAGAGGG - Intronic
1030324160 7:108202586-108202608 ATGGAATAAGTAAATGAAGAGGG - Intronic
1031316419 7:120262863-120262885 ATGTAAAATATGAAAAAAGATGG - Intergenic
1032254973 7:130289895-130289917 ATGGATTTTCTAAAAGATGAAGG - Intergenic
1033135617 7:138781624-138781646 ATAGAAAATCTGAAAGAGGCTGG - Intronic
1033569870 7:142617139-142617161 ATAGAACATCTGAGAGATGATGG + Intergenic
1033575975 7:142685307-142685329 ATGCAATATCTAAGAGAATATGG - Intergenic
1033892398 7:146031326-146031348 ATGGAATATTTACAAGAATATGG + Intergenic
1034034894 7:147808765-147808787 ATTGACTATCCCAAAGAAGAGGG + Intronic
1035358196 7:158292119-158292141 CTGGCATTTCTGAAAGAAGCAGG - Intronic
1035970806 8:4246161-4246183 ATGGAATATTGGAAGAAAGAGGG - Intronic
1038317365 8:26498462-26498484 TTGGAATATGTGAAAGTAGTTGG - Intronic
1038336588 8:26650590-26650612 ATGGAATATCTTAAAATCGATGG - Intronic
1038994840 8:32910167-32910189 GGGGAACATCTCAAAGAAGAGGG + Intergenic
1039300606 8:36204831-36204853 GAGGAACATCTCAAAGAAGATGG - Intergenic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1039787003 8:40842679-40842701 TTTGAATTTCTGCAAGAAGAAGG + Intronic
1040665801 8:49631312-49631334 ATGCAAAATCTTCAAGAAGAGGG - Intergenic
1041894668 8:62909299-62909321 ATTAAATATATCAAAGAAGATGG + Intronic
1041920273 8:63174754-63174776 ATGAAATATCTAAATAAAGAGGG - Intronic
1041957108 8:63568450-63568472 CAGGAATTTCTGAAGGAAGATGG - Intergenic
1041982158 8:63874478-63874500 AGGGAAGATCAGAAAGAAGAGGG + Intergenic
1042040622 8:64585324-64585346 ATGGGACATCTGAAAGAAACAGG + Intergenic
1042104093 8:65306156-65306178 AAGGAATATATTAAAGAAAAAGG - Intergenic
1042789487 8:72587930-72587952 ATTGAAAATCTGAAAGAGAATGG + Intronic
1043210278 8:77505331-77505353 GTAAAAAATCTGAAAGAAGAGGG - Intergenic
1044021371 8:87109957-87109979 TTGGAATATCAGGAAAAAGAAGG - Intronic
1045030233 8:98128031-98128053 ATGGCATATTTAAAACAAGAGGG - Intronic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1045833570 8:106493426-106493448 ATGGACCATCTGAAACCAGACGG + Intronic
1046182013 8:110662236-110662258 ATGGAATATCTGAAAAACAAGGG - Intergenic
1047098785 8:121653712-121653734 ATAGAATATATGAAACCAGAAGG + Intergenic
1047142802 8:122160938-122160960 ATGGAATATCACAAATAAAATGG - Intergenic
1047897035 8:129377729-129377751 AGGGAAAATCTGAAAGGAGGGGG - Intergenic
1047986816 8:130243903-130243925 ATGTAATCTCTCAAAGAAGGTGG + Intronic
1048542939 8:135359368-135359390 ATGGAACAACTGAAGCAAGATGG - Intergenic
1048603637 8:135945247-135945269 ATGGAAAATCCAAGAGAAGATGG - Intergenic
1048715752 8:137266882-137266904 ATGCACTATCTGAAAAGAGATGG - Intergenic
1048871997 8:138806841-138806863 ATGGAAGATGGGAAAGAAGTGGG + Intronic
1050286520 9:4108401-4108423 ATGGAAACTCTGAGGGAAGAAGG + Intronic
1051032612 9:12700297-12700319 ATGGAATATTTAAAGAAAGAAGG - Intronic
1052127578 9:24796836-24796858 AGGGAACATGTCAAAGAAGAGGG + Intergenic
1052428350 9:28334182-28334204 ATGAAATATAAGAAAGAAGATGG + Intronic
1052580968 9:30353261-30353283 ATGGAAAGGCTGAAAGAAAAAGG - Intergenic
1052659728 9:31412887-31412909 ATGGAATATCAAAAGGAATAAGG + Intergenic
1053563663 9:39224038-39224060 ATGGAATATCTGAATATATAAGG - Intronic
1053829450 9:42061964-42061986 ATGGAATATCTGAATATATAAGG - Intronic
1054133484 9:61395028-61395050 ATGGAATATCTGAATATATAAGG + Intergenic
1054601109 9:67125490-67125512 ATGGAATATCTGAATATATAAGG + Intergenic
1055996088 9:82161476-82161498 ATGGAATATCTGAAGGATTGAGG - Intergenic
1056153657 9:83814239-83814261 ATGCAAAATCTGAAGAAAGAGGG - Intronic
1056337226 9:85584377-85584399 AAGGAATACATGAAAGAGGAAGG - Intronic
1056356834 9:85808861-85808883 ATGCAAAATCTGAAGAAAGAGGG + Intergenic
1056648418 9:88435628-88435650 ATGTAATATCAGAAAAAGGAAGG - Intronic
1056652167 9:88475140-88475162 GTGGAATATGCCAAAGAAGATGG + Exonic
1056833776 9:89937452-89937474 ATTATTTATCTGAAAGAAGAAGG + Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1058138655 9:101335317-101335339 ATGAAAGGTCTGAAAGATGAGGG + Intergenic
1059369809 9:113818933-113818955 GTGGAGTAACTGAAATAAGAGGG + Intergenic
1059935869 9:119310091-119310113 ATGGAATTTCAGAGATAAGAAGG + Intronic
1061228420 9:129295369-129295391 ATTGAATTTGTGAAAAAAGAAGG - Intergenic
1061613674 9:131765054-131765076 GTGGCATTTCTCAAAGAAGACGG + Intergenic
1203735276 Un_GL000216v2:132743-132765 ATGGAAGCTCTGAAAGACTAGGG - Intergenic
1203417784 Un_KI270364v1:2803-2825 TTTGAAGAGCTGAAAGAAGAAGG + Intergenic
1186323020 X:8451266-8451288 AGGGAATCACTGAAAGATGAAGG + Intergenic
1187084929 X:16032171-16032193 ATAGAATAACTAAAAGTAGAAGG - Intergenic
1187378698 X:18780746-18780768 ATGGGAGAGCTGAAAGAGGAGGG + Intronic
1188970497 X:36609533-36609555 ATGGAATCAATGAAGGAAGAAGG - Intergenic
1189103940 X:38218607-38218629 CTGGAACTTCTGAAAGAAGATGG - Intronic
1189134237 X:38532599-38532621 CTGGAATAACATAAAGAAGAAGG - Intronic
1190524245 X:51311883-51311905 ATGGAATATTAGTAATAAGAAGG + Intergenic
1191141395 X:57119968-57119990 GTGGAATATACCAAAGAAGATGG - Exonic
1191143040 X:57135936-57135958 GTGGAATATACCAAAGAAGATGG - Exonic
1192608756 X:72546421-72546443 ATGGATTATCAGTAAGATGAAGG + Intronic
1193051792 X:77109580-77109602 ATCAAATATATGAAAGCAGAGGG + Intergenic
1193365041 X:80622400-80622422 ATGGACAAACTGAAAGAAGTAGG - Intergenic
1193429089 X:81378111-81378133 ACAGAATATCTGAAAAATGAGGG - Intergenic
1194457937 X:94127517-94127539 ATGGTAGTTCTGAAAAAAGAAGG - Intergenic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196760114 X:119193311-119193333 AGGGAATATGGGTAAGAAGAGGG + Intergenic
1197067210 X:122247630-122247652 GTGGGATATCTCAAAGCAGAGGG - Intergenic
1197224273 X:123940811-123940833 GTGGAATATCTAAGAAAAGAAGG - Intergenic
1197537001 X:127702564-127702586 AAGGAAGATCTGAAAAAGGAAGG - Intergenic
1198684371 X:139211969-139211991 TGGGAATGTCTGAAAGCAGATGG - Intronic
1198873128 X:141196552-141196574 ATGGGATATCAGAGAGAAAAAGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199581464 X:149364678-149364700 ATAAAACAGCTGAAAGAAGATGG + Intergenic