ID: 915171136

View in Genome Browser
Species Human (GRCh38)
Location 1:153977868-153977890
Sequence TGCTCTCTCCTTAAAACCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915171134_915171136 -9 Left 915171134 1:153977854-153977876 CCCTCTCAGGACTTTGCTCTCTC 0: 1
1: 0
2: 2
3: 28
4: 344
Right 915171136 1:153977868-153977890 TGCTCTCTCCTTAAAACCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 73
915171135_915171136 -10 Left 915171135 1:153977855-153977877 CCTCTCAGGACTTTGCTCTCTCC 0: 1
1: 0
2: 0
3: 34
4: 284
Right 915171136 1:153977868-153977890 TGCTCTCTCCTTAAAACCCGAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915171136 Original CRISPR TGCTCTCTCCTTAAAACCCG AGG Intergenic
903828777 1:26162509-26162531 TCCTCCCTCCTTAATAACCGAGG - Exonic
915171136 1:153977868-153977890 TGCTCTCTCCTTAAAACCCGAGG + Intergenic
916262823 1:162859714-162859736 TGATCTCTGATTAAAAGCCGGGG - Intronic
916408034 1:164516868-164516890 TGCTGTGTCTTTAAAAGCCGGGG - Intergenic
918194461 1:182208441-182208463 TGCTATTTCCTTAACACTCGTGG + Intergenic
920201622 1:204263137-204263159 TGCTCTCTCCTTGTTTCCCGCGG - Intronic
921261644 1:213389646-213389668 TGCTCTCTCCTGAACATCCGTGG + Intergenic
1068405015 10:56576285-56576307 TGTTTTCTCCTTGAAACCCATGG - Intergenic
1071479533 10:86054530-86054552 TGCTCTCTCCTTTACACCCAGGG - Intronic
1074932589 10:118144169-118144191 TGCTCGGGCCTTAAAACCCAAGG - Intergenic
1076128351 10:127993675-127993697 GGCTGGCTACTTAAAACCCGGGG + Intronic
1076725816 10:132412506-132412528 TGTTCTCTCCTGGAGACCCGGGG + Intronic
1077513792 11:2988126-2988148 TGCTTTCTTCTTGAAACCCCAGG - Intronic
1096602729 12:52742016-52742038 TGCTTTCTCCTTAGAACAGGAGG - Intergenic
1107734891 13:43388683-43388705 TGCTCTCTCCTACCCACCCGAGG - Intronic
1113976155 13:114228984-114229006 TGCTTTTGCCTTAAAACCCCAGG + Intergenic
1117013110 14:51491023-51491045 TGCCCTCTCCCCAAAACCCTGGG + Intronic
1118298671 14:64594732-64594754 GGCTCTCTCCTTTAAGCCCTAGG - Intergenic
1202863562 14_GL000225v1_random:100581-100603 TTCTCTCTGCTGAAAACGCGTGG - Intergenic
1123461976 15:20480959-20480981 TGCTCTCTCGTTAAAAGGTGTGG + Intergenic
1123656080 15:22519427-22519449 TGCTCTCTCGTTAAAAGGTGTGG - Intergenic
1124272662 15:28296948-28296970 TGCTCTCTCGTTAAAAGGTGTGG + Intronic
1124309990 15:28614599-28614621 TGCTCTCTCGTTAAAAGGTGTGG - Intergenic
1138536658 16:57663870-57663892 TGGTCTCTCCTTACAACCCCTGG + Exonic
1141117138 16:81318820-81318842 TGCTCTCTCTACATAACCCGGGG - Intronic
1141686704 16:85574434-85574456 TGCTATCCCATCAAAACCCGAGG + Intergenic
1142471582 17:166080-166102 TGCTCTGTCCTTCAGACCCCGGG + Intronic
1143971177 17:10797082-10797104 TGCTCTTTCCATAAGACCAGGGG - Intergenic
1144643962 17:16956039-16956061 TACTGTCTCTTTAAATCCCGTGG - Intronic
1147774549 17:42891446-42891468 TGCTCCCTCCTCAAAGCCTGGGG - Intergenic
1150070913 17:62149131-62149153 TGTGCTCTCCTGCAAACCCGGGG + Intergenic
925387622 2:3473158-3473180 TGCTCTCTCTGCAGAACCCGAGG - Intronic
928482296 2:31694662-31694684 TCCTTTCTCCTGAAAACACGTGG - Intergenic
930852055 2:55972113-55972135 TTCCCTCTCCTTAAAACCTTGGG + Intergenic
933172848 2:79142489-79142511 TTCTCTCTCCATAAAACAAGAGG + Intergenic
938572646 2:132574517-132574539 TGCTCTCTCTTGAAATCCTGGGG - Intronic
942623913 2:177878327-177878349 TCCTCTCTCCTTAAATCCGGTGG + Intronic
947887579 2:233586035-233586057 TACTCTCTCCTTAAAAGTCATGG - Intergenic
947893755 2:233648770-233648792 TACTCTCTCCTTAAAAGTCATGG - Intronic
1175245509 20:57579667-57579689 TGGTCTCCCCTGAAAGCCCGAGG + Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1175474028 20:59256649-59256671 TGCTCTCTCCTTAAAATGCATGG + Exonic
1175816197 20:61884452-61884474 TGCTCACCCCTTTAAACTCGTGG - Intronic
951971503 3:28450118-28450140 TTCTCTCTCCTTAAAACTTAAGG - Intronic
953743480 3:45556060-45556082 TGATCTCTCCCTGAAACCCAAGG + Intronic
955412927 3:58667539-58667561 TTCTCTCTCCTTAGGACCCAAGG + Intergenic
961463406 3:127067353-127067375 TTTTCTCTCCTTCAAACCCTTGG - Intergenic
962354373 3:134681128-134681150 GGCTCTCTCCTCAAAATCAGAGG - Intronic
965096514 3:164235305-164235327 AGCTCTCTGATTAAAACCCTTGG - Intergenic
966156452 3:176921989-176922011 TGCTCTCTCCCAACAACCCCTGG - Intergenic
976497247 4:85744543-85744565 TTCTCTCTCCTTAAACACTGGGG - Intronic
985625499 5:983155-983177 GGCTCTGTCCTCCAAACCCGCGG - Intergenic
989776928 5:45220116-45220138 TGCTATTTCCTTAGAACCTGTGG + Intergenic
991934721 5:71790142-71790164 TGTTCTGTGCTTGAAACCCGGGG - Intergenic
994579018 5:101614863-101614885 TGCTTTCTACTTAAAAGCAGAGG - Intergenic
999772738 5:154787721-154787743 TCCTCTGTCCTGAAAACCCACGG - Intronic
1003220077 6:4153407-4153429 TGCTCTCTCCTTAGCACCTCTGG + Intergenic
1008503966 6:52211179-52211201 TGTTCTGTCCTTAAAGCCCTAGG - Intergenic
1010161327 6:72860068-72860090 TGCCCTCTCCTGAAAAGCCAAGG + Intronic
1010960357 6:82138409-82138431 AGGTCTCTCCACAAAACCCGGGG - Intergenic
1011189130 6:84712374-84712396 TGCTCCCACCTTTAAACACGGGG - Intronic
1015803929 6:137089852-137089874 TCCCCTCTCCTTAAATCACGAGG - Intergenic
1016431433 6:143989997-143990019 TGCACCCTCCCTAAAACCAGAGG + Intronic
1019595506 7:1856548-1856570 CGCTCTCTGCTTATCACCCGCGG + Intronic
1020364944 7:7371187-7371209 TTTGCTCTCCTTAAAACCAGAGG - Intronic
1021838577 7:24704425-24704447 TCTTCTCTCCTTAAAAACTGAGG - Intronic
1026897477 7:74018578-74018600 TGCTCTCTCCTTGAAATCACCGG - Intergenic
1029650784 7:101890044-101890066 TTCTCTCTCCCTAAATCCCCGGG - Intronic
1032010288 7:128342369-128342391 TGCTCTCTGCTTAAAATCAGTGG + Intronic
1035930653 8:3776493-3776515 TGCTCTCTCTTAAACACCCTGGG + Intronic
1044988705 8:97776463-97776485 TCCTTTCTTCTTAAAGCCCGTGG + Intronic
1058187661 9:101874458-101874480 TACTCTCTCTTTAGAACCTGGGG + Intergenic
1059403378 9:114084763-114084785 TGCTCTTTCCTGAAACCACGAGG + Intergenic
1060091722 9:120748805-120748827 TTCTCTCTCCTTAAACCCAGTGG + Intergenic
1203740763 Un_GL000216v2:175431-175453 TTCTCTCTGCTGAAAACGCGTGG + Intergenic
1188110601 X:26192927-26192949 TGCCATCTCCTTACAACCAGGGG - Intronic
1189388036 X:40553669-40553691 TGTTCTCTCCTTCAAGCCCAGGG + Intergenic
1189477233 X:41365471-41365493 TGCTATCTGCTTAAACCCCATGG + Intergenic
1191247349 X:58238385-58238407 GTCTCTCTCCTTAGAACACGTGG - Intergenic
1194557546 X:95379690-95379712 TGCTCTCTCCATAAAACTTCAGG + Intergenic
1200231354 X:154445303-154445325 TGCCCTCTCCTCATAACCCTTGG + Intronic