ID: 915181343

View in Genome Browser
Species Human (GRCh38)
Location 1:154063380-154063402
Sequence TAGGGATCTAAAGTTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915181343 Original CRISPR TAGGGATCTAAAGTTGTTGA GGG Intronic
902527182 1:17066809-17066831 TGGAGATCTAAAGATGTTTAGGG - Exonic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
913253885 1:116937073-116937095 TATGGATCTGAAGCTGGTGAAGG + Intronic
915181343 1:154063380-154063402 TAGGGATCTAAAGTTGTTGAGGG + Intronic
917683330 1:177390665-177390687 TATGCCTGTAAAGTTGTTGATGG - Intergenic
1064517779 10:16169233-16169255 TAGGGATGCAATGTTGTTTATGG + Intergenic
1064566740 10:16647299-16647321 TAGGTATGTAAAGTGGTTGCAGG + Intronic
1065042359 10:21710432-21710454 TAGGCATCTAGAGTTCTTAATGG + Intronic
1068037151 10:51775279-51775301 TAGCGGTCTAAAGTAGTTAATGG + Intronic
1070432533 10:76355567-76355589 TAGGTATTTAAAGTTATTGCTGG + Intronic
1071409352 10:85373677-85373699 TGGGGAACTAAAGTTGCAGATGG + Intergenic
1077928973 11:6710778-6710800 TAGGGTTCTATAGTTCTGGAGGG - Intergenic
1078962960 11:16301004-16301026 TAGGGAAGAAAAGTTGATGAGGG - Intronic
1081844826 11:46232793-46232815 AAGGGATTTAAAGTTGCAGATGG + Intergenic
1087200415 11:95339097-95339119 AAAGGATCTAAAGATGCTGAAGG + Intergenic
1092032513 12:5299569-5299591 TATAGACCTATAGTTGTTGAGGG + Intergenic
1093376734 12:18437558-18437580 TAGTTATCTGAAGTTGTTAAAGG + Intronic
1093738433 12:22652040-22652062 TAGGGATAGAAAGTAGATGACGG - Intronic
1094408777 12:30147799-30147821 TGGGGATCTAAAATTTTTGGTGG - Intergenic
1095650128 12:44597874-44597896 TAAGGATCTAGAAATGTTGAGGG + Intronic
1098384838 12:69907684-69907706 TAGGCACCTAAAATTTTTGATGG - Intronic
1100318299 12:93465874-93465896 TATGGTTCTTAACTTGTTGAGGG + Intergenic
1101883948 12:108645410-108645432 TAATGAAGTAAAGTTGTTGATGG - Exonic
1102936452 12:116901219-116901241 TGGGGATGTAAAGTGGTGGATGG + Intergenic
1104769080 12:131349430-131349452 GAGGGACCTGAAGTAGTTGAGGG - Intergenic
1109171535 13:59104044-59104066 TAGTGTTCTAATGTTGGTGAGGG - Intergenic
1112087258 13:96044710-96044732 TATGCATATAAAGTTGTTCATGG - Intronic
1114454561 14:22846529-22846551 AAGGAATCTAATCTTGTTGAGGG + Exonic
1115750088 14:36480474-36480496 TTGAGATCTAAAGATGTGGAAGG - Intronic
1125179167 15:36861911-36861933 TAGAAATCTATAGATGTTGATGG + Intergenic
1126226522 15:46276946-46276968 TAGGCATCTCAAGGAGTTGAAGG + Intergenic
1129625048 15:77188498-77188520 TAGGGGTCTAAAGTGGTTTCAGG - Intronic
1133897080 16:9940147-9940169 AAGTGATGTAAACTTGTTGAAGG - Intronic
1140922967 16:79555870-79555892 TAGGGATATAAACCTGTTAATGG + Intergenic
1144255309 17:13461824-13461846 TTGGGATCTAGAGGTGTGGAAGG + Intergenic
1147301809 17:39535264-39535286 TAGGTATCTGAAGTTGTAAATGG + Intronic
1147675586 17:42202793-42202815 TTGGCAGCTAAAGCTGTTGATGG - Exonic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1151874675 17:76860675-76860697 TTGGGATCTAGAGGTGATGAAGG - Intergenic
1160435440 18:78848684-78848706 TACGGATACAAAGATGTTGATGG - Intergenic
1168000014 19:53438149-53438171 TAGTGTTCTAAAGTTGTGTAAGG + Intronic
930344891 2:50167722-50167744 TAGGCATCAAAATTTGTTAAAGG - Intronic
931123539 2:59248087-59248109 TAAGGATCTAAAGATGATTAGGG - Intergenic
931499195 2:62845459-62845481 TAAGGAGCTAGAGTTGATGATGG + Intronic
935976974 2:108587701-108587723 AAGGGATCTAATTTAGTTGAAGG - Intronic
938739603 2:134218740-134218762 TAAGGATATAGACTTGTTGATGG + Intronic
943830648 2:192456502-192456524 TAGAGATCTAAAGTACATGATGG + Intergenic
945497621 2:210528292-210528314 TAGGGATCTAAAGTAGTTCTGGG - Intronic
945590853 2:211729374-211729396 AAGGGATATAAAAATGTTGATGG - Intronic
946694799 2:222344335-222344357 ACAGGATCTAATGTTGTTGAGGG - Intergenic
1170669741 20:18420738-18420760 TAGGAAGCTCAAGTTGTTAATGG - Intronic
1170910194 20:20558701-20558723 TAGGAATCTTAATTTGTTGCTGG - Intronic
1173886776 20:46466015-46466037 TAGGAAACTAGAGGTGTTGATGG + Intergenic
1177523689 21:22265115-22265137 TAGGGATCAACAGTTATTAAAGG + Intergenic
950602393 3:14046060-14046082 TAGGGATCTTAATTTCCTGAGGG + Intronic
955010095 3:55005362-55005384 AATGGATCTAAAGTCTTTGATGG + Intronic
955176520 3:56619580-56619602 TTGGAATTTAAAGTTGTTGACGG - Intronic
955688888 3:61571206-61571228 TAGGAAACTAAAGTTGAAGAAGG + Intronic
960320641 3:116231446-116231468 TAGGGATCTAAATTTTATAAAGG + Intronic
962366143 3:134784817-134784839 TAGGGGTCTAATGTTGTTTTGGG + Intronic
966470775 3:180286447-180286469 GAGGGATTTAAAGATGTTGAGGG + Intergenic
967374667 3:188787393-188787415 GAGAGATCTAAAGTTGTCAAAGG - Intronic
967870794 3:194227342-194227364 TGGGGCTCTAAAGGTGATGAGGG - Intergenic
969967472 4:11012053-11012075 AAAGGATCTACAGTTGATGATGG - Intergenic
970670289 4:18388938-18388960 TGGGGATCTAAAGATGTATATGG + Intergenic
971014083 4:22469511-22469533 TAGGGACTTAAAGCTGTAGATGG - Intronic
973056783 4:45669357-45669379 TAGAAAGCTAAAGATGTTGAAGG - Intergenic
973124115 4:46562532-46562554 AAGTGAACGAAAGTTGTTGATGG - Intergenic
975336345 4:73180836-73180858 TGGGGGTCTAAAGTTATAGATGG - Intronic
975907275 4:79228498-79228520 TAGGGACATAAAGTGGGTGAGGG - Intronic
981262329 4:142736275-142736297 TAGGGAAATAAATTAGTTGAAGG - Intronic
981517741 4:145628654-145628676 TAGGGAATTAAAGTTGCAGATGG - Intronic
981894680 4:149784369-149784391 TAAGGATCTAAAGAAGGTGAGGG - Intergenic
986417923 5:7546951-7546973 TAATGATGTAAAGTTGTTTATGG - Intronic
986639118 5:9854526-9854548 TAAGGAACAAAGGTTGTTGAAGG + Intergenic
989480134 5:41921168-41921190 TAGGAATGTAAAGTTATTGTGGG - Exonic
991531368 5:67618864-67618886 TAGGGATCTAATCTTGATCAGGG + Intergenic
993454995 5:88117637-88117659 TAGGATTGTAAATTTGTTGAGGG - Intergenic
995198265 5:109397822-109397844 TAGTGGTTTAAAGTTGTTGTTGG - Intronic
999036650 5:148359097-148359119 TAGGGAGATCAAGATGTTGATGG - Intergenic
1000138390 5:158377391-158377413 TAGGGATATAAATTTTTAGATGG - Intergenic
1006331678 6:33395974-33395996 TAGGACTCTACAGTTTTTGAAGG - Intronic
1007684516 6:43657288-43657310 GAGGGATCTAATGATGATGATGG + Intronic
1009286251 6:61821861-61821883 TAGGTGTCTGAAGTTGTTTAAGG + Intronic
1011730233 6:90255026-90255048 TAGGGCTCTGAAGTTTGTGAAGG - Intronic
1013958466 6:115868570-115868592 TTAAGATCTAAAGCTGTTGATGG + Intergenic
1021927082 7:25543977-25543999 TAGGGCTATAAATATGTTGAGGG + Intergenic
1026811068 7:73465604-73465626 AAGGGATCTAGAGTTGGTGGTGG + Intronic
1030636236 7:111952336-111952358 TAGGGATCTGAAGGTCCTGATGG + Intronic
1032286659 7:130542727-130542749 TTGGGATGTAAATTTGATGACGG + Intronic
1033945051 7:146706299-146706321 TTGGGCTATAAAGTTGCTGAGGG - Intronic
1039230548 8:35442183-35442205 CAGGGACCTACAGTTATTGAAGG + Intronic
1039619428 8:38983011-38983033 TATGTATGTAAAGTGGTTGAAGG + Exonic
1042775924 8:72431098-72431120 TAGGAAGCTAAAGTGGTGGAGGG + Intergenic
1059550761 9:115226534-115226556 TAGGGAACTAGAGATGTGGAAGG - Intronic
1187460747 X:19484794-19484816 TATGGAACTACAGATGTTGAGGG + Intronic
1188786582 X:34353838-34353860 TAGTGCACTAAATTTGTTGAAGG + Intergenic
1192040706 X:67618357-67618379 TAGGATTCAAAAGTTGTTCAGGG + Intronic
1199932809 X:152541594-152541616 TATGTATCTAATGTTTTTGAAGG - Intergenic