ID: 915181833

View in Genome Browser
Species Human (GRCh38)
Location 1:154068382-154068404
Sequence TGTAGAAAGCTGAAACTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915181827_915181833 17 Left 915181827 1:154068342-154068364 CCTATTTAATAAATGGTGCTGGG 0: 12020
1: 7596
2: 5649
3: 4358
4: 2859
Right 915181833 1:154068382-154068404 TGTAGAAAGCTGAAACTGGGTGG 0: 1
1: 0
2: 0
3: 21
4: 257
915181825_915181833 18 Left 915181825 1:154068341-154068363 CCCTATTTAATAAATGGTGCTGG 0: 12127
1: 7537
2: 5239
3: 3741
4: 2189
Right 915181833 1:154068382-154068404 TGTAGAAAGCTGAAACTGGGTGG 0: 1
1: 0
2: 0
3: 21
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915181833 Original CRISPR TGTAGAAAGCTGAAACTGGG TGG Intronic
901136131 1:6997497-6997519 TGTAAAAACCTGAAATTGAGAGG - Intronic
905211967 1:36380632-36380654 TGTAGTATGCTGAATCGGGGTGG + Intronic
906541675 1:46591592-46591614 TGTAGAAAGCTGACAAAGGTGGG + Intronic
906571644 1:46846613-46846635 TCCAGGAAGCTCAAACTGGGTGG + Intergenic
906714497 1:47956702-47956724 GTGAGGAAGCTGAAACTGGGTGG + Intronic
906753662 1:48288842-48288864 GCCAGGAAGCTGAAACTGGGTGG + Intergenic
906927574 1:50135513-50135535 TGTAGAGGGTTGAAGCTGGGAGG - Intronic
907490632 1:54806776-54806798 TGGAGAAAAATGAAGCTGGGAGG + Intronic
907650346 1:56288818-56288840 TGTAGAAAGTTGGAAGTGAGTGG - Intergenic
908098991 1:60771158-60771180 GCCAGAAAGCTCAAACTGGGTGG + Intergenic
910398431 1:86814269-86814291 ATTAGGAAGCTCAAACTGGGTGG + Intergenic
910398740 1:86817485-86817507 ATTAGGAAGCTCAAACTGGGTGG - Intergenic
910473320 1:87578642-87578664 TGGAGAAGGCCGGAACTGGGAGG + Intergenic
911117917 1:94265409-94265431 AGTAGAAAACTGAAATTGGAGGG - Intronic
912852890 1:113142321-113142343 TCAAGAAAGCTGTAACTGAGTGG - Intergenic
913934003 1:125015732-125015754 GATAGGAAGCTGGAACTGGGTGG + Intergenic
915181833 1:154068382-154068404 TGTAGAAAGCTGAAACTGGGTGG + Intronic
915390752 1:155541820-155541842 TTTAGAAATATTAAACTGGGAGG + Intronic
915947948 1:160167694-160167716 TGTAGACAGCAGAAGCTGGTTGG + Intronic
916896984 1:169174345-169174367 TGTGGAGAACTGAAACTGAGTGG - Intronic
918836855 1:189476201-189476223 TGTAGAATGCTAAAACAGAGTGG - Intergenic
919070036 1:192742755-192742777 GGCAGAAAGCTGAATCTGGGTGG - Intergenic
920753322 1:208703177-208703199 GGCAGGAAGCTCAAACTGGGTGG + Intergenic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
921038666 1:211407928-211407950 TCCAGGAAGCTCAAACTGGGTGG - Intergenic
921437708 1:215145531-215145553 TTTAGAAAGCTGGATCTTGGTGG - Intronic
921455435 1:215365594-215365616 ACTAGGAAGCTCAAACTGGGTGG - Intergenic
921673877 1:217955775-217955797 TGTAGAAGGCTGCAGCTGGCTGG - Intergenic
923123222 1:231013468-231013490 TGCAGAAAGCTCAAATTGGAAGG - Intergenic
924633779 1:245766045-245766067 AGTAGAAAGCAGTACCTGGGAGG + Intronic
924796193 1:247294075-247294097 TGTAGAAACCAGAACCTGGAGGG + Intergenic
1064007144 10:11707825-11707847 TGCAGCAACATGAAACTGGGAGG + Intergenic
1065155156 10:22862194-22862216 TGTAGAAAGAAGCCACTGGGAGG - Intergenic
1066093647 10:32051961-32051983 TATTGAAATCTGAAACTTGGGGG - Intronic
1067193369 10:44091376-44091398 GCCAGAAAGCTCAAACTGGGTGG + Intergenic
1068115765 10:52736025-52736047 GCCAGGAAGCTGAAACTGGGTGG - Intergenic
1068420596 10:56786794-56786816 TCCAGAAAGCTGAAAATGTGAGG + Intergenic
1068755225 10:60645480-60645502 TTTGGGAGGCTGAAACTGGGTGG + Intronic
1069547105 10:69336586-69336608 GGTAGAAAACTAAAGCTGGGAGG - Intronic
1070064703 10:73021982-73022004 GCCAGAAAGCTCAAACTGGGCGG + Intronic
1071080983 10:81810733-81810755 AGTAGAATGCTGAAAATGAGTGG - Intergenic
1071212382 10:83358868-83358890 TGTAAAAAGCTGCATCTGGCTGG + Intergenic
1071349680 10:84727601-84727623 CCAAGGAAGCTGAAACTGGGTGG + Intergenic
1071572922 10:86707933-86707955 TGCAGAAAGATGAAACTTTGAGG + Intronic
1071825000 10:89316563-89316585 GCTAGGAAGCTCAAACTGGGTGG + Intronic
1071828553 10:89349718-89349740 TGTTGAAAGCTGTAAGTTGGAGG - Intronic
1074199550 10:111222708-111222730 AGAAGAAAGTTGAAACTAGGAGG - Intergenic
1074809408 10:117088197-117088219 TGCAGAAAACTGTACCTGGGTGG + Intronic
1075345404 10:121678581-121678603 TGTAGAAACCTGAGAAGGGGAGG - Intergenic
1075616801 10:123895817-123895839 TGAAGAACTCAGAAACTGGGGGG - Intronic
1078900881 11:15641490-15641512 TGTGGAGAGCTGAAGCAGGGAGG + Intergenic
1078981190 11:16536793-16536815 GACAGAAAGCTCAAACTGGGCGG + Intronic
1079605707 11:22363237-22363259 GGTGGAAAGCTGAAAGGGGGTGG + Intronic
1081720494 11:45285440-45285462 TCTAGAGAGCTGAATCCGGGAGG - Intronic
1083107922 11:60376402-60376424 TGTAAAATGCTGAAGTTGGGGGG + Intronic
1085940334 11:81199978-81200000 TGCAAACAGCTGAAAGTGGGTGG + Intergenic
1087050945 11:93885791-93885813 TATAGAAAGCTAGAACTGGCCGG - Intergenic
1090216287 11:124968307-124968329 TCTAGGAAGCTCGAACTGGGTGG - Intronic
1092441302 12:8507641-8507663 TGTAGAAATCAGAATCTAGGTGG - Intergenic
1093275179 12:17116781-17116803 TCTGGGAAGCTCAAACTGGGTGG + Intergenic
1094106519 12:26817689-26817711 TCTAAAAAGATGAAACTAGGTGG - Intronic
1095065058 12:37762182-37762204 GCTGGAAAGCTCAAACTGGGTGG + Intergenic
1095280171 12:40342048-40342070 TGCAGAAAGAAGAAACTGAGTGG - Intronic
1097309738 12:58105482-58105504 TGTAGACAGATGATGCTGGGAGG + Intergenic
1097727893 12:63095401-63095423 TGTAGAAAGCTGAAAATGTCTGG + Intergenic
1099549337 12:84023598-84023620 TGTAGAAAGCTGAAAGTGTAAGG + Intergenic
1099677880 12:85785896-85785918 GCCAGAAAGCTCAAACTGGGTGG + Intergenic
1099977564 12:89562131-89562153 TGGTGAAAGCCTAAACTGGGAGG + Intergenic
1100858764 12:98782409-98782431 TGTTGAAAGCTCAAAGTGGAAGG - Intronic
1102201268 12:111059567-111059589 TACAGAAAGCTGACCCTGGGTGG - Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1105295964 13:19088145-19088167 TGTAGACAGCCAAAGCTGGGTGG + Intergenic
1105557827 13:21462674-21462696 TTTAGAAATCAGAAACTGGTCGG - Intergenic
1106815894 13:33406798-33406820 AGTAGAGAGCTGAAACAGGAAGG + Intergenic
1107289807 13:38839716-38839738 TCCAGGAAGCTCAAACTGGGTGG - Intronic
1108599574 13:51980567-51980589 TGAAGAAATCAGAAACTGGGTGG + Intronic
1108682020 13:52788558-52788580 TGTAAAGAGCAGAAACTAGGTGG - Intergenic
1109080521 13:57893978-57894000 TGTTGAAAGCTGAGACAGGATGG + Intergenic
1109963899 13:69667215-69667237 TCCAGGAAGCTCAAACTGGGTGG + Intergenic
1111548930 13:89782629-89782651 TGGAGAAACTTGAAACCGGGAGG + Intergenic
1112650657 13:101393514-101393536 TGTGAAAAGCTGAAACTTAGTGG + Intronic
1113444328 13:110353907-110353929 TGTAGAAAAGTGTTACTGGGAGG + Intronic
1114538296 14:23436728-23436750 TGGATAAAGCTGAGGCTGGGTGG - Intergenic
1114891695 14:26932627-26932649 TGTAAAAAGCTAAAACAGGTAGG + Intergenic
1119266387 14:73265248-73265270 TTTAGGAAGCTGAATCTGGCTGG + Intronic
1120941149 14:89951054-89951076 TGTAGCAATCTGAAATTGGGTGG - Intronic
1122122595 14:99562327-99562349 GGTAGAAGGGTGAAACTGGCTGG - Intronic
1123990769 15:25681755-25681777 AGTAAAAAGATGAAACTGGCTGG + Intronic
1126332637 15:47549950-47549972 TGAAGAAAGGGAAAACTGGGTGG - Intronic
1126333935 15:47565585-47565607 TGTACAATTCTGAATCTGGGAGG + Intronic
1126615095 15:50569886-50569908 TGTAGAAAGCTTAAACTTCCAGG - Exonic
1127657295 15:61067798-61067820 TGTAGGAAGCTGAGAATGGATGG - Intronic
1128677517 15:69622664-69622686 GGTGGGAAGCTCAAACTGGGTGG - Intergenic
1130410033 15:83639591-83639613 TGTAGAAGGGTGCATCTGGGAGG + Intergenic
1130578894 15:85117336-85117358 AGTAGGAAGCTGAACCTGGAAGG + Intronic
1131799384 15:96053613-96053635 TTTATAAAGGTGAAACTGGAGGG - Intergenic
1132314998 15:100883233-100883255 TGTAGAAAGATGAAATTTCGTGG - Intronic
1133605909 16:7387639-7387661 GGAAGAAAGGTGAAACTGGAAGG + Intronic
1134212579 16:12290014-12290036 TGGAGAACGCTGAGACAGGGCGG + Intronic
1136521613 16:30800252-30800274 TTTAGAAAGCAGAAAATGGATGG - Intergenic
1138810688 16:60146335-60146357 GGAAGAAAGTTGAAACTTGGAGG - Intergenic
1139075194 16:63437620-63437642 TGTGGAAAGCTGAAAATATGTGG + Intergenic
1140294758 16:73697919-73697941 TGTAGAAAACAAAATCTGGGTGG - Intergenic
1142641363 17:1287893-1287915 TGTGGGAGGCTGAAACGGGGAGG - Intronic
1145095212 17:20019420-20019442 TGTATTAAGGTGAAACTGAGTGG + Intronic
1146739949 17:35274853-35274875 TCCAGGAAGCTCAAACTGGGTGG + Intergenic
1146976014 17:37112668-37112690 CATAGAAGGCTGAATCTGGGGGG + Intronic
1148138522 17:45311544-45311566 TGTAGTAACCAGAACCTGGGAGG + Intronic
1149805360 17:59612356-59612378 GGTAAAAAACTGAAACTGGTGGG - Intergenic
1151301224 17:73228252-73228274 TATAGAAAGCTGAAACTTCAAGG - Intronic
1153902106 18:9626531-9626553 GGGAGAAAGCTGAGGCTGGGAGG + Intergenic
1154028881 18:10733049-10733071 TGAAGAAAAAGGAAACTGGGAGG + Intronic
1154136567 18:11785209-11785231 TCTAGAAAGCTGAAAATGAGAGG + Intronic
1156132636 18:33996297-33996319 TATAGAAAGTTGAAAATGGAAGG + Intronic
1159734837 18:72082734-72082756 TGTATAAAGCAGAAAATGTGTGG - Intergenic
1165538431 19:36470221-36470243 TATAGAAGTCTGGAACTGGGAGG - Intronic
1165907505 19:39203055-39203077 TCTAGAAGCCTGAGACTGGGTGG + Intronic
1167393548 19:49212072-49212094 ACTGGAAAGTTGAAACTGGGTGG - Intergenic
1168483433 19:56740675-56740697 TGTGGACAGCTGAAGCTGTGAGG + Intergenic
926817936 2:16819131-16819153 TGGAGAAAGCAGAAACAAGGGGG - Intergenic
927036531 2:19183369-19183391 TGAAGACAGCAGAAACTTGGTGG + Intergenic
927702676 2:25277750-25277772 TGCAGAAAGCTGAGACCTGGGGG + Intronic
928061264 2:28115812-28115834 GGTAGAAAAATGAAATTGGGAGG + Intronic
928462667 2:31489561-31489583 TCCTGGAAGCTGAAACTGGGAGG + Intergenic
930977908 2:57487021-57487043 TGTAGAAATGTGAAACTTAGAGG - Intergenic
931888899 2:66648240-66648262 GCTGGGAAGCTGAAACTGGGTGG - Intergenic
931975615 2:67640859-67640881 TGCAAAAAGCTAAAACTTGGAGG + Intergenic
933176510 2:79179638-79179660 TGAAAAAAGCTGAAACTGGCTGG - Intergenic
933476179 2:82793505-82793527 TGTAGAAAGCGGGAATTTGGTGG + Intergenic
933631336 2:84662599-84662621 GCCAGAAAGCTCAAACTGGGTGG + Intronic
935193489 2:100796671-100796693 TCTAGAAAGATGACACTGGGAGG - Intergenic
938559611 2:132460217-132460239 TGTAGAAAGCTGGCACAGAGGGG + Intronic
939096051 2:137834710-137834732 TGTAGAAAACTGAAAAAGGTAGG - Intergenic
939126287 2:138181409-138181431 TGTAGAATACTGAAGCTGGAAGG - Intergenic
939126294 2:138181487-138181509 TGTAGAATACTGAAGCTGGAAGG - Intergenic
939126300 2:138181565-138181587 TGTAGAATACTGAAGCTGGAAGG - Intergenic
940574424 2:155482162-155482184 TGTTGAAAGCTGAAAAGTGGTGG + Intergenic
941532403 2:166686287-166686309 TCCAGGAAGCTCAAACTGGGTGG + Intergenic
944307733 2:198196729-198196751 GCCAGAAAGCTGGAACTGGGTGG + Intronic
944972149 2:205005313-205005335 TGAAGAAAGCTGAAGGTGGTTGG + Intronic
945521709 2:210835111-210835133 TGTAGAAATAAGACACTGGGTGG - Intergenic
946692774 2:222321156-222321178 TGTAGAGAGCTGAAACTCCAGGG + Intergenic
1169471242 20:5887473-5887495 GATTGAAGGCTGAAACTGGGAGG + Intergenic
1169478306 20:5952430-5952452 TGTTGAAAGCAAAAACTGTGGGG - Exonic
1169526841 20:6437663-6437685 TTTATAAAGCTGAAAGTGGATGG + Intergenic
1170088292 20:12561581-12561603 TGCAGAAAACTGAAACTGGATGG + Intergenic
1170502085 20:16984650-16984672 TGTTGAAAGCTGAAACAGGCTGG + Intergenic
1170503403 20:16998525-16998547 TGTAGAGACCTCAAAGTGGGTGG - Intergenic
1172458970 20:35100877-35100899 TTTAGAAACCAGAAACTGGCAGG + Intergenic
1173093317 20:39997698-39997720 TGCAGAAAACTGAAACTGGAGGG + Intergenic
1176451022 21:6861309-6861331 GCCAGAAAGCTCAAACTGGGTGG + Intergenic
1178199932 21:30391760-30391782 TGATGACAGCTGAAATTGGGAGG - Intronic
1178957391 21:37035625-37035647 AGTAGAAAGCTAAAACTGCCTGG + Intergenic
949586745 3:5447812-5447834 TGTAGAAAGCTGAAGTTAGTGGG - Intergenic
951402404 3:22249771-22249793 TGTTGAAAGCTAAAATTGTGGGG + Intronic
951768135 3:26223571-26223593 TGTAGAAAGGTGGGACTGGAGGG + Intergenic
951833767 3:26959350-26959372 TAAACAAAGCTCAAACTGGGTGG - Intergenic
952501832 3:33970338-33970360 GGGAGCAAGCTCAAACTGGGTGG - Intergenic
952632197 3:35482767-35482789 AGCAGGAAGCTCAAACTGGGTGG - Intergenic
953821991 3:46214823-46214845 AGCAGAAAGCAGACACTGGGGGG + Intronic
954178452 3:48862645-48862667 TGAAGAAGCCTGAATCTGGGAGG + Exonic
956219113 3:66883477-66883499 TGGAGAAAGCTGAACCTAAGGGG + Intergenic
958569452 3:95860870-95860892 GCTGGAAAGCTCAAACTGGGTGG + Intergenic
959594313 3:108112584-108112606 TGTAGATCGCTGAAAGTTGGAGG - Intergenic
960357170 3:116667892-116667914 TGATGAAAGCTGACACTGGGAGG - Intronic
961935182 3:130575547-130575569 TGTAGCAAGCTGGAAATGTGGGG - Intronic
962582027 3:136806724-136806746 TGAAGAAAGCTGAAAGTAGAGGG + Intergenic
963191734 3:142480731-142480753 GCTGGAAAGCTGGAACTGGGTGG - Intronic
964155042 3:153575126-153575148 TCTTGACATCTGAAACTGGGAGG + Intergenic
964413845 3:156427252-156427274 TCTAGATATCTGAAGCTGGGAGG - Intronic
964681869 3:159349835-159349857 TCTAGAAAGTTCAAACTGGAAGG - Intronic
965221420 3:165931564-165931586 TCTGGGAAGCTCAAACTGGGTGG + Intergenic
966296149 3:178426147-178426169 TCAAGAAAGTTGAACCTGGGAGG - Intronic
966659375 3:182397450-182397472 TCTTGAAAGCTGAAGCTGGGGGG - Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
968074226 3:195807637-195807659 GGTAAAAGGCTGAAACTAGGGGG + Intronic
969990031 4:11252805-11252827 TGTAGAAAGCAGAAAGTGAAGGG + Intergenic
970702627 4:18760740-18760762 TTTAGAAAGATCAACCTGGGTGG + Intergenic
971356575 4:25900428-25900450 TGTAGAAATATAAAATTGGGAGG - Intronic
971937680 4:33173537-33173559 TGTAGCAACCTTAAACTGGTTGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973592798 4:52459449-52459471 TCCAGGAAGCTCAAACTGGGTGG + Intergenic
974491845 4:62573416-62573438 TGTAGAAAGCTCAAAATTGTAGG + Intergenic
974587046 4:63892916-63892938 TTTAGAAAGCAGAAGCTGGGTGG - Intergenic
974690662 4:65293762-65293784 GCCAGAAAGCTCAAACTGGGTGG - Intergenic
975067230 4:70082024-70082046 TCTAAAAAGCTGAAATTGGCTGG + Intergenic
975235902 4:71996513-71996535 GCTGGAAAGCTCAAACTGGGTGG + Intergenic
976112629 4:81692273-81692295 AATAGAATGCTGGAACTGGGTGG + Intronic
978418437 4:108503605-108503627 GCTAGAAAGCTCGAACTGGGTGG + Intergenic
978575165 4:110182606-110182628 TATAGAAAACTGGAACAGGGAGG + Intronic
979840304 4:125431004-125431026 TGTAGAAAGCAAATGCTGGGGGG - Intronic
982765573 4:159344358-159344380 TGCAGAAAGCTCAAAGTAGGGGG + Intronic
983353798 4:166629864-166629886 TGTAGAAATGTTGAACTGGGAGG + Intergenic
983975033 4:173923234-173923256 TGCAGAAAGCAGCAACTTGGCGG + Intergenic
989682055 5:44041386-44041408 GCCAGAAAGCTCAAACTGGGTGG + Intergenic
989828390 5:45886758-45886780 TCTGGAAAGCTCGAACTGGGTGG - Intergenic
990578191 5:57143883-57143905 TGTTCAATGCTGAAACTGGAGGG + Intergenic
991686052 5:69183433-69183455 TTTAAAAAGATGAAACTGGCCGG - Intergenic
992142192 5:73809701-73809723 TTTAGAAAGCTGAAACTTCAAGG + Intronic
992232016 5:74672778-74672800 TGGAGAAAGCTGAACCGGGAGGG - Intronic
992644444 5:78798821-78798843 TGCAGAAAACTGAAGCTGGCTGG + Intronic
993742270 5:91555859-91555881 GCTGGAAAGCTGGAACTGGGTGG + Intergenic
994103139 5:95915966-95915988 TGCAGAAAGCTCAATCTGGATGG + Intronic
994560448 5:101364344-101364366 TGTAGAAAGTAGAATCTAGGAGG - Intergenic
995647195 5:114326321-114326343 GGCAGAAGGCTGAAAGTGGGAGG + Intergenic
996004296 5:118402800-118402822 TGAAGAAAATTGAAACTGGATGG - Intergenic
997991626 5:138549359-138549381 TGTAGAAAAATGAAACAGGCTGG + Intergenic
998241731 5:140452217-140452239 GCTAGGAAGCTCAAACTGGGTGG + Intronic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
999461999 5:151765661-151765683 TGTTGAAAGCTGAAGTGGGGTGG - Intronic
1003452385 6:6247398-6247420 TGAAGAAATGTTAAACTGGGTGG - Intronic
1005622532 6:27633163-27633185 TGTAGCAAGCTGAAAGAGTGAGG + Intergenic
1005918435 6:30375755-30375777 TGAGGAAAGCAGAAACTAGGAGG - Intergenic
1007015823 6:38465569-38465591 TGCAGTGAGCTGAGACTGGGAGG + Intronic
1007919678 6:45595089-45595111 TGTAGAAATCTGAAAAGAGGTGG + Intronic
1008901689 6:56626508-56626530 TGTAGAAAGCTGTAACATGTAGG + Intronic
1009998683 6:70925642-70925664 GCCAGAAAGCTCAAACTGGGTGG + Intronic
1012643305 6:101649856-101649878 TGCAGAAGGGTGAAAGTGGGTGG + Intronic
1013262814 6:108463044-108463066 TGTGGGAGGCTGAGACTGGGTGG + Intronic
1014112528 6:117635427-117635449 TGTTGAAAGGTGAAGCTGGCTGG - Intergenic
1015133463 6:129840378-129840400 TGCAGAAAACTGAAACTGGATGG + Intronic
1016018496 6:139210977-139210999 GGCAGGAAGCTCAAACTGGGTGG + Intergenic
1016590897 6:145742299-145742321 TGTAAAAAACTGCCACTGGGAGG + Intergenic
1017356985 6:153521142-153521164 TCTGGGAAGCTCAAACTGGGTGG - Intergenic
1020006349 7:4785442-4785464 TGCAGAAAGCTGTAAGTGGCTGG + Exonic
1020600646 7:10270700-10270722 TCCAGGAAGCTGGAACTGGGTGG + Intergenic
1022309219 7:29179353-29179375 TGAAGAAGGCTGACACTGTGTGG - Intronic
1022745357 7:33166510-33166532 TGGAGGAAGCTCAAACTTGGCGG - Intronic
1023485071 7:40677524-40677546 TGTTCATAGCAGAAACTGGGAGG + Intronic
1025930580 7:65990441-65990463 AGGAGAATGGTGAAACTGGGAGG + Intergenic
1028838880 7:95404734-95404756 TGTGGAAAGCTGAAAGTGAATGG - Intergenic
1029330254 7:99847695-99847717 TTTAGAAAGCTCAAACTCAGTGG - Intronic
1031348721 7:120701749-120701771 TGCAGAAGATTGAAACTGGGGGG + Intronic
1032397980 7:131604452-131604474 TGGAGAAAGCTGAAGCTGAGAGG + Intergenic
1033101503 7:138476708-138476730 TGCAGAATGCTAAAACTGGAAGG + Intronic
1034030833 7:147761573-147761595 TGTAGAAGGCTCAAACTAGGTGG + Intronic
1036745695 8:11407618-11407640 GCCAGAAAGCTGAAACTGGGTGG - Intronic
1037688359 8:21162797-21162819 TGGAGAAAGATGAAATAGGGAGG - Intergenic
1037908712 8:22730581-22730603 CCTAGAAAGCTGAAACTGCCCGG + Intronic
1038127069 8:24686256-24686278 TGTAGAAAGAAGGAAATGGGAGG - Intergenic
1038463655 8:27739790-27739812 TGCAGAAAATGGAAACTGGGTGG - Intronic
1038748941 8:30278489-30278511 TGTAGAAATCTGAAATTAAGGGG + Intergenic
1040473075 8:47752430-47752452 TAAACAAAGCTCAAACTGGGCGG + Intergenic
1040795367 8:51284783-51284805 TGTAGAAATCAGAAAGTAGGAGG - Intergenic
1043291962 8:78613210-78613232 GGAAGAAAGTTGAAACTGGGAGG - Intergenic
1043545302 8:81308366-81308388 TGAAGACAGCAGAAACTAGGTGG - Intergenic
1044700350 8:94959876-94959898 TGTAAACATCCGAAACTGGGGGG - Intronic
1045256362 8:100526993-100527015 TGTGGAAGGCTGAAACTGCATGG + Intronic
1045737298 8:105311226-105311248 GGGAGAAAGCTTAAACTGGTAGG + Intronic
1050814788 9:9796680-9796702 AGTAGAAAGCTGAATTTGGAAGG + Intronic
1052328206 9:27239853-27239875 TCCAGGAAGCTCAAACTGGGCGG + Intergenic
1052382321 9:27784966-27784988 TCTAGGAAGTTCAAACTGGGTGG - Intergenic
1052786245 9:32831095-32831117 TCTGAAAAGCTGAAAATGGGAGG + Intergenic
1053610482 9:39708470-39708492 TGTACACAGCTGAAAGTGCGCGG + Intergenic
1054087770 9:60762686-60762708 TGTACACAGCTGAAAGTGCGTGG - Intergenic
1054243041 9:62633925-62633947 TGTACACAGCTGAAAGTGCGCGG - Intergenic
1054557165 9:66668443-66668465 TGTACACAGCTGAAAGTGCGCGG - Intergenic
1055004607 9:71491300-71491322 TGTAGAAAGTTAGAGCTGGGAGG - Intergenic
1056804109 9:89714682-89714704 GGTAGGAAGCTGAACCTGGTGGG - Intergenic
1058417953 9:104807457-104807479 TGTGGAATTCTGAAACTGGAAGG - Intronic
1058559900 9:106216008-106216030 TGAAGAAAGGAGAAACTGGTTGG - Intergenic
1059345004 9:113622008-113622030 TGTTCAAACTTGAAACTGGGTGG - Intergenic
1059866048 9:118514907-118514929 AGTAGAAGGATGAAACTGAGAGG - Intergenic
1060403773 9:123362841-123362863 TGTAGAAAGAAGAAACTGGCTGG - Intronic
1203518159 Un_GL000213v1:23208-23230 GCCAGAAAGCTCAAACTGGGTGG - Intergenic
1203614607 Un_KI270749v1:47535-47557 TTTGGAAAGTTGCAACTGGGAGG + Intergenic
1186933886 X:14425816-14425838 TGTAGCAATCTGAAACTGAAAGG - Intergenic
1187229748 X:17409469-17409491 TGTAAAAAGGTGAAACTGGAAGG + Intronic
1191588846 X:62858567-62858589 TCCAGGAAGCTCAAACTGGGTGG + Intergenic
1191635143 X:63367915-63367937 TCCAGGAAGCTCAAACTGGGTGG + Intergenic
1191649339 X:63519602-63519624 GGCAGGAAGCTGCAACTGGGTGG + Intergenic
1193154352 X:78157528-78157550 TCCAGGAAGCTCAAACTGGGTGG - Intergenic
1193328687 X:80212205-80212227 AGTAAAAAACTGAAACTGTGGGG - Intergenic
1193837172 X:86358047-86358069 TGAAGAAAGATAAAACAGGGTGG - Intronic
1196712011 X:118772104-118772126 TGTAGAAATTTGAAAATGTGAGG + Intronic
1198041092 X:132853124-132853146 TGTTTAAAACTGAAAATGGGGGG - Intronic
1198851811 X:140972753-140972775 TTTAGAAAGCTGTATCTGGAAGG + Intergenic
1201541562 Y:15110563-15110585 GCTAGGAAGCTCAAACTGGGCGG - Intergenic
1201903659 Y:19068056-19068078 TGGAGAAACTTGAAACAGGGAGG - Intergenic