ID: 915182717

View in Genome Browser
Species Human (GRCh38)
Location 1:154077027-154077049
Sequence ATCTTTCATCAGAAACCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 1, 2: 9, 3: 35, 4: 268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915182712_915182717 12 Left 915182712 1:154076992-154077014 CCCTCATAAGGGATCTTCCATGG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG 0: 1
1: 1
2: 9
3: 35
4: 268
915182714_915182717 11 Left 915182714 1:154076993-154077015 CCTCATAAGGGATCTTCCATGGG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG 0: 1
1: 1
2: 9
3: 35
4: 268
915182711_915182717 13 Left 915182711 1:154076991-154077013 CCCCTCATAAGGGATCTTCCATG 0: 1
1: 0
2: 0
3: 5
4: 119
Right 915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG 0: 1
1: 1
2: 9
3: 35
4: 268
915182716_915182717 -5 Left 915182716 1:154077009-154077031 CCATGGGATTAATAGCTGATCTT 0: 1
1: 0
2: 0
3: 15
4: 218
Right 915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG 0: 1
1: 1
2: 9
3: 35
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915182717 Original CRISPR ATCTTTCATCAGAAACCATG AGG Intronic
900493563 1:2965629-2965651 ATCTATCATTACAAACCATGAGG + Intergenic
905162958 1:36053213-36053235 ATATTTAATCAGAAACCTTAGGG + Intronic
907182591 1:52583921-52583943 ATCTTTCACCAAAACCCATAAGG - Intergenic
908154531 1:61338942-61338964 TTCTTTCAAAAGAAACCATTTGG + Intronic
908970592 1:69824508-69824530 AAATTTCACCAGAAATCATGCGG - Intronic
911485447 1:98499341-98499363 ATTTTTCCTCAGCAACCATGTGG - Intergenic
915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG + Intronic
916268099 1:162912218-162912240 ATTTCTCATCAGAAACAATGGGG - Intergenic
917495828 1:175539369-175539391 ATCTTTGATGCAAAACCATGTGG - Intronic
919420366 1:197363538-197363560 ATTTCTCATTTGAAACCATGGGG - Intronic
919454861 1:197809194-197809216 ATCATGCATGAGAAACCATGAGG - Intergenic
919764758 1:201119800-201119822 CTCTTTCAGCAGTCACCATGGGG - Intronic
921281266 1:213570453-213570475 ATGCTTCTTCAGGAACCATGAGG - Intergenic
922121351 1:222672500-222672522 ATCCTGAATCCGAAACCATGGGG - Intronic
922829569 1:228544950-228544972 CTCTTTCAACAGAAAGCCTGGGG + Intergenic
922831053 1:228554592-228554614 GTCTTTCATTAGAAAGCCTGGGG + Intergenic
922983292 1:229847043-229847065 ATGTGTCATCAGCCACCATGAGG - Intergenic
923396685 1:233572796-233572818 ATCTTTTATAAGAATCCAAGGGG - Intergenic
923401603 1:233620217-233620239 ATAGTTGAACAGAAACCATGTGG + Intronic
924388130 1:243519704-243519726 AGCTTTCATGAGAAATCATTAGG + Intronic
1064081072 10:12308394-12308416 ATCTTTGTTATGAAACCATGAGG - Intergenic
1064179564 10:13102381-13102403 ATATTGCAAAAGAAACCATGAGG + Intronic
1064614713 10:17141075-17141097 ATGTCTCATCCAAAACCATGAGG - Intergenic
1065672615 10:28137137-28137159 ACTTCTCATCAGAAACAATGTGG + Intronic
1065732816 10:28724819-28724841 ATCATTTATCAGAAAAGATGGGG - Intergenic
1066105528 10:32153506-32153528 ATTTCTCATCAGAAACCATGAGG - Intergenic
1067272016 10:44800078-44800100 ATTTTTCTTCAGAAACCACGGGG + Intergenic
1067774736 10:49154921-49154943 ATCTTTCATCACACACAAGGAGG + Intronic
1068628595 10:59275956-59275978 ATCTTTCCTTAGAAAACAAGGGG + Intronic
1068802311 10:61155808-61155830 ATCTGTCATCAGAGAATATGTGG - Intergenic
1069658722 10:70109353-70109375 TTCATCCTTCAGAAACCATGGGG + Intronic
1071238633 10:83679048-83679070 ATCTTTCATAAGAAGCAATAAGG - Intergenic
1072896248 10:99369619-99369641 TTTTTTCATCAAAAACCATCTGG + Intronic
1073988732 10:109239611-109239633 ATCTTTTAACAGAAAGTATGTGG - Intergenic
1074030170 10:109679317-109679339 ATCTTTCAAAAGAGATCATGAGG + Intergenic
1074302290 10:112243291-112243313 ATCTTCCAGCAGCCACCATGTGG - Intergenic
1074694562 10:116037402-116037424 ATTTCTCATCAGAAACAATGGGG - Intergenic
1074978386 10:118599393-118599415 AGCTTTCTTAATAAACCATGGGG - Intergenic
1075006996 10:118838316-118838338 TTGTTTCAACAGAGACCATGTGG + Intergenic
1076628388 10:131836094-131836116 ATTTCTCATCAGAAATCGTGGGG + Intergenic
1077983005 11:7320737-7320759 TTCTTTCATAGGAAAGCATGAGG - Intronic
1078769664 11:14337021-14337043 ATTTCTCATCAGAAACCATGGGG + Intronic
1080751854 11:35157988-35158010 CTATATCATCAGAAACTATGCGG - Intronic
1083337868 11:61936719-61936741 ATTTCTCATCAGAAACCATGGGG + Intergenic
1083777502 11:64901488-64901510 ATCTTTCATCAAAAACAGGGAGG - Intronic
1085247233 11:75112408-75112430 GTTTATCATCAGAAACTATGGGG + Intronic
1085595598 11:77806270-77806292 ATCTTTCCCAAGACACCATGAGG - Intronic
1086075776 11:82850341-82850363 ATATTTCATCCTAAACCAGGCGG + Exonic
1086343704 11:85873867-85873889 ATCATTCATGAGATACCTTGAGG - Intronic
1086736333 11:90309894-90309916 ATATTACATCAGCAAGCATGAGG - Intergenic
1088327592 11:108616770-108616792 ATCTCTCAGGAGAAACCAGGAGG - Intergenic
1088658116 11:112020821-112020843 ATTTTTCATCAGAAACGACTGGG + Intronic
1089013696 11:115149693-115149715 ATTTGTGATCTGAAACCATGGGG + Intergenic
1089957720 11:122587467-122587489 ATTTTTCATCAGAAACCATGGGG - Intergenic
1090243763 11:125201665-125201687 ATTTTTCATCCGACACCATCAGG + Intronic
1090442740 11:126737496-126737518 ATCCTTCCCCAGAATCCATGGGG - Intronic
1091140737 11:133232262-133232284 CTCTTTGATGAGAAACCATACGG + Intronic
1092828776 12:12423591-12423613 ATTTCTCATCAGAAACCTAGGGG - Intronic
1094150712 12:27279764-27279786 CTCTTTCATTATAAACCGTGTGG - Intronic
1094683645 12:32688497-32688519 ACTTCTCATCAGAAACCATAGGG - Intronic
1096446080 12:51693276-51693298 ATCTTTCCTAAGAAGCAATGTGG - Intronic
1098742137 12:74186233-74186255 ATTTTTCAACAGAAACCTTACGG + Intergenic
1102982507 12:117253357-117253379 ATCCTTCAGCACAAACAATGGGG + Intronic
1103662526 12:122532566-122532588 ATTTTTCAACAGCAACCTTGAGG - Intronic
1105309320 13:19192252-19192274 ATTTCTCATCAGAAAACATGAGG + Intergenic
1105400544 13:20090623-20090645 ATCCTTCATCTGAAACCCTTAGG + Exonic
1105528272 13:21195889-21195911 ATTTCTCATCAGAAAACATGAGG - Intergenic
1106926349 13:34617278-34617300 ACCTTTCTTCAGAATTCATGTGG - Intergenic
1108234426 13:48388512-48388534 AATTTTCATCATAATCCATGAGG + Intronic
1108822901 13:54375441-54375463 ATTTCTCATCTGAAACCAAGGGG + Intergenic
1109136067 13:58653138-58653160 ATCTTTAAAGAGAAACCATCTGG + Intergenic
1109160838 13:58971725-58971747 ATAGTACATCAGAAACCATGTGG + Intergenic
1109647072 13:65272710-65272732 ATCATCCATCAGTATCCATGGGG + Intergenic
1111461750 13:88553345-88553367 ATTTTTCATCAGAAACCATAGGG - Intergenic
1112201506 13:97280834-97280856 ATTTTTAATCAGAAACCTTAAGG - Intronic
1112752851 13:102599201-102599223 ATCTTTCATCACCAACTATTTGG + Intronic
1112890600 13:104225861-104225883 ATTTTTCAGCTGAAATCATGAGG + Intergenic
1114028475 14:18553217-18553239 ACTTCTCATCAGAAACAATGTGG - Intergenic
1114873334 14:26684649-26684671 GACTCTCCTCAGAAACCATGAGG - Intergenic
1115382312 14:32754839-32754861 ATTTTTCAGCAGAAACTTTGCGG - Intronic
1115626420 14:35197733-35197755 ATCTTTCATAAGACAAAATGGGG - Intronic
1119373867 14:74172234-74172256 CTTTTACATCAGGAACCATGGGG + Intronic
1119460655 14:74799568-74799590 ATCATTCCTCAGAAATGATGGGG + Exonic
1119519328 14:75274240-75274262 ATCTTTCATCATGAACCACTGGG + Intergenic
1121213046 14:92223528-92223550 ATGTTACATCACTAACCATGTGG - Intergenic
1122234614 14:100324646-100324668 ATCTTTCCTCCGGAGCCATGAGG + Intronic
1122361309 14:101167587-101167609 ATTTTGCATCTGAAACCATGAGG - Intergenic
1124070274 15:26385616-26385638 ATCATTCTTCATAAACCCTGTGG + Intergenic
1124124197 15:26923426-26923448 ATTTCTCATCAGAAACCTGGAGG - Intronic
1126170441 15:45691178-45691200 ACCTTTGAACAGCAACCATGTGG + Exonic
1126282153 15:46966167-46966189 ATGTTTCATCAGAACCCCTGGGG + Intergenic
1127537788 15:59906742-59906764 ATCTGTAACCATAAACCATGGGG + Intergenic
1128378241 15:67092500-67092522 CTCTTGGATCAGAAACCCTGAGG + Intronic
1128411997 15:67408865-67408887 ATTTTAAAGCAGAAACCATGTGG - Intronic
1130210995 15:81921572-81921594 ATCTTTCATCAGAAACTAGAAGG + Intergenic
1131014933 15:89050327-89050349 ATGTCTCAGCAGCAACCATGTGG + Intergenic
1133198461 16:4187453-4187475 ATGTATCATCTGAATCCATGGGG - Intergenic
1137049354 16:35694663-35694685 ATATTTCATCAGAATGCCTGGGG + Intergenic
1138311760 16:56030171-56030193 ATTTCTCAGCTGAAACCATGGGG + Intergenic
1139008174 16:62599206-62599228 TTCTATCATCAGAAACCTTGAGG - Intergenic
1140422454 16:74831803-74831825 ATTTTTCAGCAGAAGCCATTTGG + Intergenic
1140634480 16:76895228-76895250 ATTTCTCATCAGAGACAATGGGG + Intergenic
1140863485 16:79039675-79039697 ATCTTTCTTAAGAAAACATGAGG + Intronic
1140988365 16:80182600-80182622 AACTTTCAGCAGAAAACATAGGG + Intergenic
1141028616 16:80569724-80569746 CTGTATTATCAGAAACCATGAGG + Intergenic
1141204381 16:81922215-81922237 ATGTTTCATAAGAAGCAATGTGG - Intronic
1142004285 16:87681948-87681970 AGCTTTCATCAGATTCCAGGAGG - Intronic
1143251123 17:5523861-5523883 ATCTATCATCTGAAAAAATGAGG + Intronic
1143315794 17:6032610-6032632 ACCTTTCATTAGAATCCCTGAGG + Intronic
1143592057 17:7891125-7891147 AGCTTTCATCAGATTCCAAGGGG - Intronic
1143851616 17:9817123-9817145 ATTTTTTATCAGAAATCTTGGGG + Intronic
1144510348 17:15869564-15869586 ATCTTTTCTCAGAAAGCATCTGG - Intergenic
1144794833 17:17883979-17884001 AGCTTCCTTGAGAAACCATGAGG + Intronic
1145113821 17:20189553-20189575 ATCTCTCCTCAGAAACACTGAGG + Intronic
1145174505 17:20687289-20687311 ATCTTTTCTCAGAAAGCATCTGG - Intergenic
1146737489 17:35251354-35251376 GTGTTGCATGAGAAACCATGAGG - Intronic
1146771868 17:35576268-35576290 ATTTTTCATCAGAATCACTGGGG + Intronic
1148574600 17:48700643-48700665 ATTTTTTAAAAGAAACCATGGGG - Intergenic
1149140130 17:53422297-53422319 ACCTTCCATCAGAAACCTTGGGG + Intergenic
1150154233 17:62837294-62837316 ATTTCTTATCAGAAACCATGGGG + Intergenic
1150889784 17:69134564-69134586 ATCTTTCATCAAAAATCTTGAGG + Intronic
1151493788 17:74447462-74447484 GACGTTCATCAGAAACCAGGAGG - Intronic
1153417679 18:4867080-4867102 ATTTCTCATAAGAAACTATGAGG + Intergenic
1155212274 18:23612249-23612271 GGCTTTCATCATAAACCATCTGG + Intronic
1156591009 18:38488410-38488432 ATCTTTTATCAGCACCCCTGAGG + Intergenic
1157791324 18:50533828-50533850 ATTTCTCATCAGAATCCATATGG - Intergenic
1157837039 18:50914117-50914139 CTTTTTCATCAGAAATCTTGGGG - Intronic
1157982073 18:52393417-52393439 ATCTTGAATCAGAAACTCTGAGG + Intronic
1159785224 18:72705556-72705578 ATTTCTCATCAAAAATCATGAGG + Intergenic
1159895596 18:73992724-73992746 CTCTTTCATCAGCAACCAGGAGG + Intergenic
1162257872 19:9507139-9507161 ATATGTCATCAGAAATCATGGGG - Intergenic
1164115255 19:22213577-22213599 ATCTTTCATAAGACAACCTGAGG - Intergenic
1164372275 19:27653051-27653073 ATCTTTCATTAGAATGCCTGGGG + Intergenic
1168593802 19:57657662-57657684 ATCATTCCTCAGTATCCATGGGG + Intergenic
925002321 2:415026-415048 ATTTTTCAGCAGAAACCTAGAGG - Intergenic
925618009 2:5762284-5762306 ATCTTCCTTCAGAAACCACAGGG + Intergenic
925734364 2:6948373-6948395 AGCTGTCAGCAGCAACCATGAGG - Intronic
926241932 2:11095031-11095053 ATCTTTCAACAGAAATCACATGG - Intergenic
926392699 2:12410111-12410133 AACTTTAATCAGAAACCCTATGG - Intergenic
928595637 2:32856611-32856633 ATCTCTCATCAAAAACCTGGAGG + Intergenic
928722586 2:34137564-34137586 ATCATCCATCAGAATCCATGGGG - Intergenic
930119005 2:47744478-47744500 ATCCTGCATCAGAAAGAATGAGG + Intronic
930343214 2:50144122-50144144 ATTAGTCTTCAGAAACCATGTGG - Intronic
930432720 2:51301190-51301212 ATCTTTCAGCAGAAACTCTCTGG + Intergenic
933003290 2:76954853-76954875 ATTTATCAGCAGAAACCTTGTGG + Intronic
933100771 2:78253997-78254019 ATCCATAATCAGAAAGCATGTGG - Intergenic
933161661 2:79030825-79030847 ATTTGTCATCAGAAACCATTAGG + Intergenic
934474191 2:94581997-94582019 ATTTTTTATAATAAACCATGTGG - Intergenic
934707508 2:96494424-96494446 ACTTCTCATCAGAAATCATGGGG - Intergenic
936272661 2:111061319-111061341 ATTTCTCATCAGAAACCACAGGG + Intronic
936831016 2:116647068-116647090 ATCTTACATCACAAACTATCAGG + Intergenic
937995149 2:127688669-127688691 ATGTCTCATCAGAAGCAATGGGG - Intergenic
938514395 2:131987860-131987882 ATGTTTTATCAGAAATAATGGGG + Intergenic
940114364 2:150192160-150192182 AGTTTTCATCAGCAACCATCTGG - Intergenic
940592208 2:155743821-155743843 ATTTCTCAGCAGAAACCCTGCGG + Intergenic
940800539 2:158127985-158128007 ATCTTTCATCAGAATGTTTGGGG - Intronic
941379277 2:164772650-164772672 AACTTTCAACACAAACCATTTGG + Intronic
941633035 2:167905139-167905161 ATCTTTTATCTGAAATCTTGGGG + Intergenic
941674030 2:168324841-168324863 CTATTTCATTAGAAACCTTGAGG - Intergenic
942593366 2:177569100-177569122 ACCTTTCACAATAAACCATGTGG + Intergenic
944593497 2:201239833-201239855 AGCTTGCATCAGAAGCCATCAGG - Intronic
946379569 2:219336530-219336552 ATTTTTCATTATAAACCATGTGG + Intergenic
946586484 2:221193967-221193989 ATCTTTCATCAGGATCCAGTGGG + Intergenic
948552223 2:238780955-238780977 ATTTCTCATCAGAAACAATACGG - Intergenic
948715734 2:239860755-239860777 ATTTATCATCAAAAATCATGGGG + Intergenic
1169560859 20:6799384-6799406 ATCTTTCATCAGAACCCCTTGGG + Intergenic
1171021718 20:21590346-21590368 GTCTTTTATCAGAAATCATATGG + Intergenic
1171137469 20:22709243-22709265 ATGGTTGATCAGAAACCCTGGGG + Intergenic
1173265824 20:41479466-41479488 ACTTTTCATAAGAAACCACGGGG + Intronic
1175498675 20:59433776-59433798 ATCTTTCACCATAGACCATTTGG - Intergenic
1176904975 21:14489462-14489484 TTCTTTCATTAAAAACAATGTGG - Intronic
1177038796 21:16079768-16079790 ATTTTTCATTAGAAATTATGTGG + Intergenic
1178350663 21:31871307-31871329 ATCTTCCATCAGAAACAGTTTGG - Intergenic
1180452598 22:15480269-15480291 ACTTCTCATCAGAAACAATGTGG - Intergenic
1180686642 22:17672690-17672712 ATACTTCATAATAAACCATGTGG - Intronic
1182162790 22:28139935-28139957 ATCTTTCTACAGAAATTATGTGG - Intronic
1182308271 22:29386688-29386710 AGCTTTCTTCAGAAGCCATGTGG + Intronic
1182406988 22:30143510-30143532 ATCTCTCAGCAGGAACAATGGGG - Intronic
1184435909 22:44475954-44475976 ATTTCTCATCAGAAACCATGCGG - Intergenic
1184975770 22:48060573-48060595 CTCCTTCCTGAGAAACCATGGGG - Intergenic
1185035142 22:48471404-48471426 ATCTTCCCTCAGTATCCATGGGG + Intergenic
950697304 3:14712990-14713012 ATTTCTCATCAGAAACCATGGGG - Intronic
951986861 3:28630409-28630431 ATATTTCATAGGTAACCATGTGG + Intergenic
953544149 3:43850151-43850173 CTCTTTTCTCAGAATCCATGAGG - Intergenic
955119796 3:56046440-56046462 ATCTTTCATGAGAAAGCAAAGGG + Intronic
955681693 3:61508006-61508028 ATTTTTCATCTGAAACCAAGGGG - Intergenic
955815241 3:62835502-62835524 CTCTTTTATGAGAAAACATGGGG + Intronic
956121154 3:65967320-65967342 ATTTTTCATAAGAAAACATCGGG + Intronic
956204857 3:66744661-66744683 ATCATTTAGGAGAAACCATGTGG + Intergenic
958744461 3:98115521-98115543 ATTTATCAGCAGAAACCTTGTGG - Intergenic
959602779 3:108207736-108207758 ATATCTCCTCAGAAACTATGGGG + Intronic
960019653 3:112934286-112934308 ATTTCTCATCAGAAACCTTATGG + Intronic
960179213 3:114554925-114554947 ATATTTCAACATAAACTATGAGG - Intronic
960821021 3:121731642-121731664 AGCTTTCTTGATAAACCATGTGG + Intronic
962727544 3:138246832-138246854 ATCTTTCTACAGAAACGATCAGG - Intronic
963367324 3:144352901-144352923 CACATTCTTCAGAAACCATGAGG - Intergenic
963655805 3:148048820-148048842 ATTTTTCATTAGAAACCATGGGG - Intergenic
963709218 3:148727259-148727281 GGCTTTCATTAGAAACCAAGTGG - Intronic
963921872 3:150913482-150913504 ATCTTTCATCAGAGAGGCTGTGG + Intronic
964337595 3:155672844-155672866 ATCTTTCATAAGAAAACATTAGG - Intronic
965676007 3:171197294-171197316 AACTTTCAGGAGAAACCATAGGG + Intronic
965819338 3:172668598-172668620 AGCCTTCATCAGCAACCGTGAGG + Intronic
965819376 3:172669078-172669100 GGCCTTCATCAGCAACCATGAGG + Intronic
966032899 3:175372506-175372528 AGCCTTTATCAGCAACCATGAGG - Intronic
971543549 4:27854148-27854170 ATTTCTCATCAGAAACATTGTGG + Intergenic
972483638 4:39522087-39522109 AACTTTAATCAGAAACCATAAGG + Intronic
972653562 4:41044002-41044024 ATCTTTCATCAGGAAGCACATGG + Intronic
973114984 4:46445221-46445243 ATCTGGCATCAGAAAAAATGGGG - Intronic
977132217 4:93254465-93254487 ATTCTTAATCAGAAACTATGGGG + Intronic
978612726 4:110561716-110561738 ATCTTTCTTCATAAACAAAGAGG - Exonic
978935507 4:114370030-114370052 ATCTTTCATCCCTAACCTTGAGG + Intergenic
980830960 4:138128790-138128812 ATCTTGCATAAGAAGCCCTGGGG + Intergenic
981050055 4:140300802-140300824 ATATTTCATCTGAAACCACCAGG - Intronic
982332084 4:154192280-154192302 ATCTATCATCTGAGAGCATGGGG + Intergenic
982561718 4:156936221-156936243 ATCTTTCTTCAGGTACTATGAGG + Intronic
982802294 4:159720475-159720497 ATCGTGCATCACAAACAATGGGG + Intergenic
983756209 4:171340295-171340317 ATGTATTATCAGAAAGCATGCGG - Intergenic
986700095 5:10398281-10398303 GTCTTTAATAAGAAGCCATGTGG + Intronic
988171630 5:27664551-27664573 ATTTTTCATCATACACCAAGAGG - Intergenic
989254731 5:39353975-39353997 ATCCTTGCTCAAAAACCATGTGG - Intronic
991200285 5:63984238-63984260 GCCTTTCATCAGAAACTATCTGG + Intergenic
992583155 5:78203066-78203088 GTTTCTCATTAGAAACCATGGGG - Intronic
993496260 5:88612845-88612867 ATTTCTCATTAGAAACCATGGGG + Intergenic
994824482 5:104695881-104695903 TTCTTTCATCAAAAACCACAAGG - Intergenic
995202289 5:109439745-109439767 ATCTTACATCAGAGGCCATTTGG + Intergenic
995775379 5:115719337-115719359 ATGTTTCATCATCAAACATGAGG - Intergenic
996197958 5:120633028-120633050 ATTTTTCAGCAGAAACCATCAGG + Intronic
998701783 5:144710867-144710889 TGCTTTCATCAGAAACCACCTGG - Intergenic
999567179 5:152877465-152877487 AACTTTGAGCAGAGACCATGGGG - Intergenic
999635845 5:153621509-153621531 CCCTTACATCAGAAACCATGTGG + Intronic
999730944 5:154476417-154476439 CTCTTTCAGCAGGAACCAAGCGG + Intronic
1000522366 5:162311785-162311807 CTTTCTCATCATAAACCATGAGG + Intergenic
1002565004 5:180107499-180107521 ATTTCTCATCAGAAACCAAGAGG - Intronic
1003445057 6:6176690-6176712 ATCTTTTAGCAGAAATCATCTGG + Intronic
1003510024 6:6771823-6771845 AGCTTTCATCAGAATACATTTGG + Intergenic
1005205936 6:23404827-23404849 TTCTTTATTCAGAAACCAAGGGG - Intergenic
1005521482 6:26604704-26604726 ATCTTTCAACAGCAATTATGGGG + Intergenic
1005531824 6:26715190-26715212 ACTTCTCATCAGAAACCATAGGG + Intergenic
1005538971 6:26786475-26786497 ACTTCTCATCAGAAACCATAGGG - Intergenic
1005767803 6:29031536-29031558 ATCTTTTATTATAAAGCATGAGG + Intergenic
1005853573 6:29842190-29842212 AATTTTCATCAGAAACCATGGGG - Intergenic
1008323252 6:50144292-50144314 ATATTTCATCATAAAACATGAGG - Intergenic
1008890007 6:56477060-56477082 ATTATTCAACAGAAACAATGTGG + Intronic
1009009810 6:57828702-57828724 ACTTCTCATCAGAAACCATAGGG - Intergenic
1010132864 6:72515743-72515765 AATTCTCATCAGAAACCACGAGG - Intergenic
1014412669 6:121146306-121146328 ATCTTTCAGAAGAAACCAGATGG + Intronic
1014557995 6:122856454-122856476 AGCATTCATCAGAATCCCTGGGG + Intergenic
1014754803 6:125291341-125291363 ATCTCTCATCTTAAACCCTGGGG + Intronic
1015055026 6:128890406-128890428 ATCTTTCATAAAATACCCTGAGG + Intronic
1015898071 6:138036125-138036147 ATTTTTCATAAGACACCATGAGG - Intergenic
1017509503 6:155101338-155101360 CTTTTTCATCAGAAACAGTGTGG + Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022019953 7:26389039-26389061 ACCTTTCATCATATATCATGTGG + Intergenic
1022609612 7:31856201-31856223 ACCTTTCATTACAAACCAAGAGG - Intronic
1023164512 7:37330063-37330085 CTCTCCCATCAGAAGCCATGTGG - Intronic
1029103609 7:98155595-98155617 ATTTCTCATCAGAAACCTGGAGG + Intronic
1030183497 7:106735802-106735824 ATTTCTCAGCAGAAACCTTGTGG - Intergenic
1030341527 7:108386042-108386064 TTCTTTCAAAAGAAACCAAGCGG - Intronic
1031212965 7:118855167-118855189 ATCTTTCATCTAAAGACATGAGG - Intergenic
1032195943 7:129788592-129788614 ATCTTAAAGCAGAGACCATGTGG + Intergenic
1032706195 7:134422908-134422930 ACTTTTCCTCAGAAACCCTGGGG + Intergenic
1035114440 7:156511554-156511576 ATTTCTCACCAGAAACCATGTGG + Intergenic
1037165018 8:15816888-15816910 CTCTTTCATGAGAAACATTGGGG - Intergenic
1038593002 8:28857918-28857940 ATCTTTTGTAAGAAACCATATGG + Intronic
1038984236 8:32791493-32791515 ATCCTTCAACAGAAACATTGGGG - Intergenic
1039006774 8:33046955-33046977 ATTTCTCATCAGAAACTGTGGGG + Intergenic
1039012306 8:33107642-33107664 ATGTTTCATCAGTATACATGAGG - Intergenic
1039139208 8:34366145-34366167 ATTTCTCATCAGATACCATAAGG - Intergenic
1041158688 8:55014855-55014877 ACCTTTCATCAGAAACCTCTTGG - Intergenic
1046170668 8:110501074-110501096 GTATTTTGTCAGAAACCATGAGG - Intergenic
1046606697 8:116379652-116379674 ATGATTCATGAGAAAACATGGGG - Intergenic
1048128592 8:131665660-131665682 ATCCTTCTACAGAAATCATGCGG + Intergenic
1048669913 8:136706806-136706828 ATATTTCAACAGAAAACATGTGG + Intergenic
1048746388 8:137619128-137619150 ATCATTGATAAGAAACTATGTGG - Intergenic
1048765095 8:137835026-137835048 ACATTTCACCAGAAACCAGGGGG - Intergenic
1049314541 8:141956156-141956178 ATTTCTCATCAGAAACCCTCAGG + Intergenic
1049648694 8:143752308-143752330 ATTTTTCATCAGAAACTTGGAGG - Intergenic
1053611931 9:39722713-39722735 ATCTCTCACCAGAAACCAACTGG + Intergenic
1053683887 9:40504134-40504156 ATTTTTTATAATAAACCATGTGG + Intergenic
1053933861 9:43132420-43132442 ATTTTTTATAATAAACCATGTGG + Intergenic
1054279834 9:63120818-63120840 ATTTTTTATAATAAACCATGTGG - Intergenic
1054296983 9:63339600-63339622 ATTTTTTATAATAAACCATGTGG + Intergenic
1054395001 9:64644106-64644128 ATTTTTTATAATAAACCATGTGG + Intergenic
1054429648 9:65149306-65149328 ATTTTTTATAATAAACCATGTGG + Intergenic
1054500734 9:65872225-65872247 ATTTTTTATAATAAACCATGTGG - Intergenic
1055191438 9:73529651-73529673 ATTATTCCTCAGAAACAATGAGG + Intergenic
1056110203 9:83387867-83387889 CTCTTAAATCAGAATCCATGGGG - Intronic
1056534358 9:87515210-87515232 TTGTTGCAACAGAAACCATGTGG - Intronic
1056607844 9:88101728-88101750 ATATTTCATAAGAAACTATAGGG + Intergenic
1057079563 9:92162593-92162615 ATTCTTCATCAGAAGCCATAAGG + Intergenic
1058732163 9:107860826-107860848 ATTTAGAATCAGAAACCATGGGG - Intergenic
1059266741 9:113039953-113039975 ATATTGGATCAGAAACCCTGTGG - Intronic
1059708835 9:116848785-116848807 ATCTTTCAGCAGACACCAGCTGG + Intronic
1061110792 9:128568875-128568897 ATTTTGCATCTGAAACCATACGG + Exonic
1062002542 9:134223984-134224006 ATCTCTCAGCAGCCACCATGGGG + Intergenic
1186117318 X:6318547-6318569 ATCTCCCACCAGAAACCGTGGGG + Intergenic
1186741532 X:12523304-12523326 ATGTTTCATGAGAGCCCATGAGG - Intronic
1186820577 X:13283886-13283908 CTCTTTCATCACAAACAAAGAGG + Intergenic
1186975979 X:14905349-14905371 GTCTTTCTTCAGTATCCATGGGG + Intronic
1187709332 X:22038116-22038138 ATCTTGACTCAGAAACCCTGGGG - Intronic
1188249517 X:27875564-27875586 ATTTCTCATCTGAAATCATGGGG - Intergenic
1189040605 X:37538605-37538627 AACTTTCCTCAGAAATTATGTGG - Intronic
1189189297 X:39084103-39084125 ATTTTTCATCAGAAACTTGGAGG + Intergenic
1189340788 X:40203104-40203126 AGCTTTCATAAAAACCCATGAGG - Intergenic
1190453752 X:50606054-50606076 ATCCTTCATTAGATCCCATGTGG - Intronic
1190629428 X:52370299-52370321 ATCTGTTATCAGTAAGCATGAGG - Intronic
1193490603 X:82144023-82144045 ATCTTTCCTTAGAAACCCTCTGG - Intergenic
1194584778 X:95718910-95718932 TTCTTGCATCAGAAGCCCTGGGG - Intergenic
1195600518 X:106742028-106742050 ATGTTTCATTAGTAGCCATGAGG + Intronic
1196159983 X:112472667-112472689 ATTTTTCATCAGAAATCATGGGG - Intergenic
1196626523 X:117883486-117883508 AACTTCCATAAGAAACCATTGGG + Intergenic
1199021846 X:142888449-142888471 ATCTCTCTCAAGAAACCATGAGG + Intergenic
1199323911 X:146475072-146475094 ATCTTTCATCAGTAAAGTTGTGG + Intergenic
1199928579 X:152495019-152495041 ATCTTTCTTCACAAAGCATCAGG - Intergenic