ID: 915184019

View in Genome Browser
Species Human (GRCh38)
Location 1:154088632-154088654
Sequence CTGTTGTTCTTCATAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915184016_915184019 -7 Left 915184016 1:154088616-154088638 CCTGTAACATCCCATACTGTTGT 0: 1
1: 0
2: 0
3: 8
4: 92
Right 915184019 1:154088632-154088654 CTGTTGTTCTTCATAATAAAAGG 0: 1
1: 0
2: 2
3: 32
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915184019 Original CRISPR CTGTTGTTCTTCATAATAAA AGG Intronic
903911344 1:26728258-26728280 CTGTTCTTCTTAATATCAAAGGG - Intronic
904762566 1:32816663-32816685 CTGTAGTTCTTGGTAACAAACGG + Intronic
904839460 1:33362887-33362909 CTGTTGAGCTACATAATTAAAGG + Intronic
905139208 1:35828047-35828069 CTGTTGTAATTCTTAATACATGG + Intronic
905772514 1:40647490-40647512 TTCTTGTTCTGCAAAATAAAAGG - Intronic
906912138 1:49965312-49965334 CTGGTCTTCTTCATTAAAAATGG + Intronic
908531958 1:65042264-65042286 CTGAAGTTCCTGATAATAAACGG - Intergenic
909133071 1:71763979-71764001 CTGTTCTTCTTTATACTACATGG - Intronic
909565768 1:77051939-77051961 CATTTGTTTTCCATAATAAATGG - Intronic
910248513 1:85168435-85168457 CTGTTGTTCCTTAGAATAGAAGG - Intronic
910535829 1:88296326-88296348 TTGTTATTCTTCATTATACATGG - Intergenic
912269190 1:108192334-108192356 GTGTTGTTATTCTTAATAAACGG + Intronic
912402918 1:109410762-109410784 CTGTTGTGCTTTGTTATAAATGG - Intronic
912500397 1:110118075-110118097 TTGTCTATCTTCATAATAAATGG - Intergenic
915184019 1:154088632-154088654 CTGTTGTTCTTCATAATAAAAGG + Intronic
918657344 1:187044828-187044850 ATCTTGTTCTTCCTAATTAAAGG + Intergenic
920917307 1:210268096-210268118 CTGTTTTCTTTCTTAATAAATGG - Intergenic
921154561 1:212429063-212429085 CTGTGGGACTTCATAAGAAATGG - Intergenic
921485390 1:215709459-215709481 CTGTTTTTCTTCTTAATAATAGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921973491 1:221176326-221176348 CTGTTGTTGTTGTTCATAAATGG - Intergenic
1062761627 10:26911-26933 CTATGCTTCTTCAAAATAAAAGG - Intergenic
1062983632 10:1746161-1746183 CTGTTGTTCTCCATAATTGCTGG + Intergenic
1063728351 10:8666010-8666032 GTGCTGTGCTTCATAATAAATGG - Intergenic
1064107163 10:12509806-12509828 CTGCCGTTCTACATAATACATGG + Intronic
1064349503 10:14563982-14564004 AGGTTATTCTTCATTATAAATGG + Intronic
1064396136 10:14983556-14983578 CTATTGTTCTTAATATTCAAAGG + Intronic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1065445769 10:25796756-25796778 CTGTTGTCCTTTATAATATAGGG - Intergenic
1065592119 10:27274181-27274203 CTCTTGTTCCTGATATTAAAGGG + Intergenic
1067073170 10:43152815-43152837 CAGTTCTTTTTCCTAATAAATGG + Intronic
1068965127 10:62904154-62904176 CTGTTGTTTTTCATTATGAAAGG + Intronic
1069117207 10:64522735-64522757 CTGTTGTTCTTCACATTTAATGG - Intergenic
1072284329 10:93898397-93898419 CTATGGTTCTTCATAATTGATGG + Intronic
1073739506 10:106390541-106390563 CTATTGTTATTCATTTTAAAAGG - Intergenic
1074146048 10:110718027-110718049 CTGTTTTTCTTCATTCTCAAAGG - Intronic
1075041513 10:119110855-119110877 CAATTGTTCTTCGTTATAAAAGG - Intronic
1075389233 10:122080537-122080559 CTGGTGTTCTTTATAAGAAGAGG - Intronic
1075708451 10:124517334-124517356 GTTTTGTTCTTCAAAATAAAGGG + Intronic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077268220 11:1662517-1662539 CTGTTATTCTTCACTACAAAAGG - Intergenic
1077272662 11:1689101-1689123 CTGTTATTCTTCACTACAAAAGG + Intergenic
1077940875 11:6841207-6841229 CTTTTGTACTTCAGAATAAACGG - Intergenic
1078970727 11:16408003-16408025 CTGTTATTCTTATTTATAAAAGG - Intronic
1081275452 11:41142882-41142904 CTGTTTTTCTGCACTATAAATGG - Intronic
1081480333 11:43480718-43480740 CTCTTCTCCTGCATAATAAAAGG - Intronic
1081539463 11:44020395-44020417 CTATTGTTCTTGATATTACAAGG + Intergenic
1081960209 11:47130461-47130483 CTGTTGTTTTATATTATAAATGG - Intronic
1082847494 11:57738494-57738516 CTGTTGTTCCTCCTAGTGAATGG - Intronic
1082949536 11:58796990-58797012 TAGTTGTTTTTCACAATAAAAGG - Intergenic
1085720070 11:78904703-78904725 CTGGTGTTCTGAATAATTAAAGG - Intronic
1086670720 11:89543371-89543393 CTATTGTTCTACATATTAATTGG + Intergenic
1088527652 11:110774074-110774096 CTGTGGTTCTTCATACTTATAGG + Intergenic
1090598348 11:128343237-128343259 CTGTTGTTCTAGTTAATAAAAGG + Intergenic
1090718737 11:129453589-129453611 CTGTTGATCTCAATAACAAAGGG - Intergenic
1091972142 12:4796532-4796554 CTGTTGTTCTTCGTAAAATGTGG + Intronic
1092969823 12:13682802-13682824 CACTTTTTCTTCATAATAGATGG - Intronic
1093685318 12:22047307-22047329 CTGATGTTATTCATAAAAGAAGG + Intronic
1094544127 12:31388422-31388444 CTGTATTTCTTCTTCATAAAAGG - Intronic
1097143568 12:56924081-56924103 CTGTTATTCTTCATAAAAGATGG + Intronic
1097988337 12:65807744-65807766 CCTTTGTTCTTCATTTTAAATGG + Intergenic
1098034863 12:66291384-66291406 TTGTTGTTGTTTATAATTAAGGG + Intergenic
1098817053 12:75180051-75180073 ATGTTGTTCTTTATTATCAAAGG + Intronic
1099430113 12:82573223-82573245 CTGTTGTTCATCATAGTATCTGG + Intergenic
1101502411 12:105316488-105316510 CTGTTGTTCAGGATCATAAAAGG - Intronic
1104233733 12:126911390-126911412 TTGCTGTTTTTCATAATAGAAGG + Intergenic
1104779804 12:131412858-131412880 CTGTTTTGCTGGATAATAAAAGG + Intergenic
1106452550 13:29895861-29895883 CTAATATTCTTTATAATAAATGG + Intergenic
1106818431 13:33435931-33435953 ATGATTTTCTTCATAATAATTGG + Intergenic
1107548139 13:41452946-41452968 ATATTGTTCTTCATAGTCAAAGG - Intergenic
1107670394 13:42740557-42740579 CTGTTGTTTTTTATTTTAAAGGG + Intergenic
1108984342 13:56564721-56564743 CTGATTTTCATCATTATAAATGG + Intergenic
1109844322 13:67965921-67965943 CTGTTGTGCTCCAGAATAAATGG - Intergenic
1110074314 13:71219335-71219357 CTTTTATATTTCATAATAAAAGG - Intergenic
1116018799 14:39436864-39436886 CTGTTGCTATTCATAAAATAAGG - Intergenic
1117134010 14:52715221-52715243 TTTGTGTTCTTCATGATAAAAGG + Intronic
1117492244 14:56260902-56260924 CTGATTTTCTTCAAAATACATGG - Intronic
1120041246 14:79755443-79755465 CTGGTTTTCTGCCTAATAAAAGG + Intronic
1120796364 14:88637352-88637374 GTGTTGTCTTTCAAAATAAAGGG + Intronic
1122160856 14:99782724-99782746 CTGTACTTCTTCCTAATTAATGG - Intronic
1124682198 15:31742076-31742098 CTTTTGTTTTTCTTTATAAAAGG + Intronic
1125085870 15:35728552-35728574 CCTTTGGTCTTCATAATCAAGGG - Intergenic
1126949769 15:53868353-53868375 CTATGGTTCTTTATAACAAAAGG + Intergenic
1127069757 15:55277450-55277472 CTGTTTGTCTCCATAATAAATGG + Intronic
1130614529 15:85392083-85392105 CTATTCTTATTCTTAATAAAAGG + Intronic
1131641325 15:94297140-94297162 CTGTTCTTTTTCATACTGAAAGG + Intronic
1133456836 16:5949683-5949705 CTGCTGTTCTACAAAACAAATGG - Intergenic
1133847625 16:9470179-9470201 CTTTTGTTCTTGACAATGAATGG - Intergenic
1134188335 16:12101348-12101370 CTGTTCTTCCTCCTACTAAATGG + Intronic
1134421872 16:14100172-14100194 GTCTTGTTCCTCATATTAAAGGG + Intronic
1136999967 16:35221296-35221318 CTGTTTTGTTTCATAATAAAGGG + Intergenic
1137423344 16:48354770-48354792 CTCTTTTTCTTCAAAATAATGGG + Exonic
1137973233 16:53006467-53006489 CTGTTGTTTGTCATAATGGATGG + Intergenic
1138049062 16:53756751-53756773 CTGCTATTCTTCAAATTAAAAGG - Intronic
1138824458 16:60302345-60302367 CTCTAGTGCTTCATGATAAAGGG + Intergenic
1140977645 16:80075544-80075566 GGGTTGTTTTTCATAAAAAATGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143977255 17:10838966-10838988 CTGTTGTTCCTCAGGATAACTGG + Intergenic
1147269507 17:39258116-39258138 CTGTTTTTTTCCATTATAAAAGG + Intergenic
1147462389 17:40581672-40581694 CTGTTCTTTTTCATAATAACAGG - Intergenic
1148917954 17:50999767-50999789 CTCTTGTTCTTCAGAAAGAAAGG - Intronic
1149332410 17:55598580-55598602 CTTTTTTTTTTCATCATAAAAGG + Intergenic
1149880143 17:60281577-60281599 CTTTTGTTATTATTAATAAAAGG - Intronic
1151209235 17:72531804-72531826 CCGTATTTCTTCATGATAAAAGG - Intergenic
1152954534 18:27241-27263 CTATGCTTCTTCAAAATAAAAGG - Intergenic
1153897017 18:9573174-9573196 CTAATGTTCTTTATAACAAAAGG - Intronic
1155109000 18:22695504-22695526 TTCTTATTCTTCAAAATAAAAGG - Intergenic
1155498929 18:26468042-26468064 GTGTGGTTCTCCATAAAAAATGG + Intronic
1156214374 18:34980785-34980807 ATGTGGTTTTTCATAATAATGGG - Intronic
1156474445 18:37396913-37396935 CTTTTGTTTTTCTTAATTAAAGG + Intronic
1157098632 18:44710119-44710141 CTTTTTTTCTTTTTAATAAAAGG + Intronic
1158367787 18:56758341-56758363 GTTTTGTTCTCCGTAATAAAAGG - Intronic
1158372715 18:56827628-56827650 CTGTTGTTCTACCAAATAATAGG - Intronic
1159129925 18:64269803-64269825 CTTTTGTTCTTTATAATTGAAGG - Intergenic
1159248219 18:65837763-65837785 ATGCAGTTGTTCATAATAAAGGG + Intronic
1159646002 18:70919185-70919207 CTGTTGTTCTTGATATTGAGGGG + Intergenic
1161109465 19:2461359-2461381 CTGTTTTCCTTCCTCATAAAGGG + Intergenic
1163328899 19:16623421-16623443 CTGCTTTTCTGCAGAATAAATGG + Intronic
1164256845 19:23534629-23534651 CTCTTTTTCTTCAAAATAATGGG - Intronic
1164810750 19:31153933-31153955 CTGTGGTTCTTCCCATTAAAGGG + Intergenic
1167112925 19:47472386-47472408 CTGTTGTTATTCTTATTAATGGG - Intergenic
927226728 2:20773668-20773690 CTGTGGTTTTTGATACTAAATGG - Intronic
929136982 2:38634245-38634267 GTGTTGTCCTTCACAAAAAAAGG - Intergenic
929268801 2:39949697-39949719 CTGTTTATTTTTATAATAAATGG - Intergenic
931296470 2:60931575-60931597 ATTTTTTTCTTGATAATAAATGG + Exonic
932018431 2:68057461-68057483 CTTTTTTTCTTCAAAATAAATGG - Intronic
932941212 2:76168759-76168781 CTTTCTTTCTTCAGAATAAAAGG - Intergenic
933213557 2:79599898-79599920 CTGTTGCTCTTCACAAGACATGG - Intronic
933365885 2:81353198-81353220 CTGTTGTTTTATATAAAAAAAGG - Intergenic
935703767 2:105838579-105838601 TTGTTATTCTACATAATAAGGGG - Intronic
935734143 2:106092897-106092919 TTGTTTTTCCTCTTAATAAATGG - Intergenic
938645797 2:133328975-133328997 TTCTTTTTCTTTATAATAAAAGG - Intronic
941080950 2:161059919-161059941 CAATTGTTCTTCCTACTAAATGG - Intergenic
941307022 2:163882556-163882578 CTGGTGTTCAGGATAATAAAGGG - Intergenic
941716904 2:168773800-168773822 TTTTAGTTCTTCATAATAATAGG + Exonic
942207910 2:173640710-173640732 CTGTTGTTCTGCATGACATATGG - Intergenic
942493170 2:176510447-176510469 CTATTGGTCTTCAGAATCAAGGG - Intergenic
943081052 2:183259671-183259693 CTGTTGTATTTTAAAATAAAAGG + Intergenic
944391005 2:199219541-199219563 ATGTTATTATTGATAATAAAAGG - Intergenic
944432987 2:199656496-199656518 CTGTTATTCTTTGTAATAACAGG + Intergenic
1169301968 20:4450683-4450705 TTATTGTTTTTCATAATACAAGG - Intergenic
1169998295 20:11584296-11584318 CGGTTGCTATTGATAATAAATGG + Intergenic
1170045070 20:12076310-12076332 CTGTGGGCCTTCATTATAAATGG + Intergenic
1170548056 20:17451882-17451904 CTGATGTGTTTCACAATAAATGG - Intronic
1171117794 20:22541341-22541363 CTGTTGGTTTTCATCACAAAAGG - Intergenic
1171146927 20:22792895-22792917 CTGTTTTTATTCATACAAAATGG + Intergenic
1171317034 20:24204423-24204445 CTGTTGTTGTTATTAATAATGGG - Intergenic
1174599109 20:51709881-51709903 CTATTATTATTCATCATAAAAGG + Intronic
1174746462 20:53068078-53068100 CTGGTGTTCTTAAAAATCAAAGG - Intronic
1177403971 21:20642392-20642414 CTGTTGTTGTTCATTGGAAAAGG - Intergenic
1177718280 21:24869103-24869125 CTTTTACTATTCATAATAAAAGG + Intergenic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1179648120 21:42788008-42788030 CAGCTGTTCTTTATAATAAAGGG - Intergenic
1181782908 22:25205947-25205969 CTCTTGTTCTTCTTAACAAGGGG + Intronic
1182981358 22:34674435-34674457 CTGCTGTTCTTCTAAAAAAATGG - Intergenic
1184114131 22:42412393-42412415 CTCTTCTTCTTCATAAAACAGGG - Intronic
951152565 3:19308963-19308985 CTGTTGTTCTCCTTACTAATTGG - Intronic
951645443 3:24885445-24885467 CTGTGGTTCTGAATATTAAATGG + Intergenic
951800863 3:26594902-26594924 TTATTGTTCTTCAAAAGAAAGGG - Intergenic
952165234 3:30740791-30740813 TTAATGTTCTTAATAATAAAGGG - Intronic
957159977 3:76598322-76598344 TTGTTGTTGTTTTTAATAAAAGG + Intronic
957228263 3:77476726-77476748 CTGCTGTTCTCCTTAATGAAAGG + Intronic
957471613 3:80666123-80666145 ATATTTTTCTGCATAATAAATGG - Intergenic
957717782 3:83953409-83953431 CTATTGTTCTTAAACATAAAAGG - Intergenic
958468445 3:94487035-94487057 CTTTTTTTCCACATAATAAAAGG - Intergenic
958969385 3:100594646-100594668 CTGATGTTCTGCAACATAAAGGG + Intergenic
962599265 3:136978471-136978493 GTCTTGTTTTTCATAATGAATGG + Intronic
964614294 3:158645574-158645596 CTGTTGTTCTCTCTTATAAAAGG + Intronic
965761852 3:172086383-172086405 CATTTGTTCTTTATATTAAAAGG - Intronic
966087637 3:176088777-176088799 TTTTTATTCTTCATCATAAAGGG + Intergenic
967483673 3:190004797-190004819 CTGGTTTTCATTATAATAAAGGG + Intronic
967619296 3:191613140-191613162 CTGCAGTTCTTCATAATATAGGG - Intergenic
969408590 4:7012676-7012698 CTGTTGTATTTAACAATAAAAGG + Intronic
970158365 4:13164297-13164319 CCTTTCTTCTTCAAAATAAAAGG + Intergenic
970213897 4:13738700-13738722 CAGTTGTTCTTTAAAAGAAATGG + Intergenic
972001738 4:34045073-34045095 CTGCAGTACTTCTTAATAAAAGG - Intergenic
972025163 4:34366352-34366374 CTGTTGATTTTCATGATTAATGG + Intergenic
972224355 4:36995450-36995472 CCATTGTTCTTTATAATAAACGG - Intergenic
973796436 4:54432372-54432394 CAGTTGTAGTTCACAATAAAAGG + Intergenic
973927003 4:55748892-55748914 ATGTTGATCTTTATAATAACTGG - Intergenic
974447768 4:62008227-62008249 TTGTTGTTGTTGATAATAATTGG + Intronic
974640590 4:64624860-64624882 CTGTTGTTTTTCATAACTCATGG - Intergenic
974806405 4:66886098-66886120 CTTCTGTTCTTAATAGTAAAGGG - Intergenic
976039542 4:80866428-80866450 CTGTTGCTCTACATACTTAAAGG + Intronic
977035026 4:91939745-91939767 CTGTTGTTTTATATAAAAAAAGG - Intergenic
977642006 4:99367885-99367907 CTCTTTTTCTTCAAAATAATGGG - Intergenic
977993163 4:103469314-103469336 CTGTTGATCTCCATTATATAAGG + Intergenic
978649229 4:110980449-110980471 ATGATGTTCTTCTTAATACATGG - Intergenic
978875434 4:113635313-113635335 CTTGTGTTCTTAATAATAACTGG - Intronic
978955008 4:114601747-114601769 CTGTTTTTGTTTATAGTAAATGG + Intronic
981095712 4:140777684-140777706 CTGTGGTTCTTCATCACAAGGGG + Intergenic
981503354 4:145475537-145475559 GTGTTATTTTTCATATTAAAAGG - Intergenic
983353183 4:166620792-166620814 ATGCTGTTCTTTTTAATAAAAGG - Intergenic
988211480 5:28210179-28210201 CCGTTGTCCTTCATAACAACAGG + Intergenic
988328456 5:29802152-29802174 CAGTTGTTCTTAATCATGAATGG - Intergenic
991481504 5:67085950-67085972 CTGTTGGTATTCATCATACAAGG + Intronic
992108752 5:73472462-73472484 CTGATATTCTCTATAATAAAGGG - Intergenic
993259182 5:85637422-85637444 GTGTTATATTTCATAATAAAAGG + Intergenic
993313423 5:86368059-86368081 CTGTTATTGATCACAATAAAAGG + Intergenic
995663073 5:114507864-114507886 CAGATGTACTTTATAATAAATGG + Intergenic
996025532 5:118641379-118641401 CTGAGGTTTTTAATAATAAAGGG - Intergenic
996770171 5:127077285-127077307 CTGTTATACTACATAATTAATGG - Intergenic
996990935 5:129630228-129630250 CTATAGTTCTTCATAATATTAGG - Intronic
997419930 5:133758061-133758083 CTGCTTTTATTCATAATCAAAGG - Intergenic
998875378 5:146593813-146593835 CTCTTCTTCCTCAGAATAAAGGG - Intronic
1000489774 5:161897129-161897151 GTGTTGTTTTTCTTAATAAGAGG - Exonic
1003176630 6:3757097-3757119 CTGTTTCTCTTCAAAACAAAAGG + Intergenic
1003204646 6:3996263-3996285 CTATTGTTTTTTACAATAAAAGG - Intergenic
1003605872 6:7560372-7560394 CTTATATTCTTTATAATAAATGG - Intronic
1003751988 6:9069376-9069398 CTGTTGTTTTTTCTTATAAATGG - Intergenic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1005033310 6:21531716-21531738 TTGTTGTTCTTGATTTTAAAAGG + Intergenic
1005417567 6:25617683-25617705 CTTTTGTTCTTAGTAATTAAAGG + Intronic
1006388569 6:33745929-33745951 TTGAAGTTTTTCATAATAAAAGG + Intronic
1006664748 6:35684479-35684501 CTGTTTTTCTTCTTAGAAAAAGG - Intronic
1007316572 6:40994000-40994022 CTTTGGTTCCTCATGATAAATGG - Intergenic
1008845157 6:55953910-55953932 TTGTTGTTTTTAATGATAAAAGG - Intergenic
1010040047 6:71370460-71370482 TTTTTTTTCTCCATAATAAAAGG + Intergenic
1010595531 6:77758425-77758447 CTCTTGTCCTTCAGAAAAAAAGG - Intronic
1010871182 6:81042673-81042695 CTGCTCTTCTCCATAATAAATGG - Intergenic
1014080363 6:117280025-117280047 CTGTGTTTTTTCATAATAATTGG - Intergenic
1014463040 6:121721170-121721192 ATTTTTTTCTTCATAATAAAAGG - Intergenic
1014750814 6:125253864-125253886 CTGATGGTCTTCAAAAGAAAAGG + Intronic
1014798499 6:125750957-125750979 CTGTTTCTCTTCATAATTCATGG - Intronic
1014863034 6:126494369-126494391 ATATTGGTCTTCAAAATAAAAGG - Intergenic
1014984999 6:127995038-127995060 CTGTTTTTCTACACAAGAAAAGG + Intronic
1015961377 6:138652874-138652896 CTGTTGGTGATTATAATAAATGG - Intronic
1016250649 6:142037230-142037252 TTGTTGGTTTTCTTAATAAAAGG - Intergenic
1016475892 6:144427587-144427609 TTTTTGTTGTTGATAATAAAAGG + Intronic
1016784631 6:147996695-147996717 TTGATGTTCTTCATCTTAAAGGG + Intergenic
1017257079 6:152346026-152346048 CTTTTGTGCTACAAAATAAATGG + Intronic
1017657095 6:156640329-156640351 CTGTTGTTTTAGAAAATAAATGG - Intergenic
1018875706 6:167820868-167820890 CCTTTTTTCTTGATAATAAAAGG - Intergenic
1020617276 7:10475634-10475656 CTGTCGTTTTTCAGAAGAAATGG - Intergenic
1021499505 7:21315216-21315238 CTGTTTTTTTAAATAATAAAAGG - Intergenic
1021962099 7:25883537-25883559 CTGTTTTTCTTCAAGATTAAGGG - Intergenic
1022339604 7:29455879-29455901 CTGTTGTTGTTCTTAATGCAGGG - Intronic
1022563763 7:31376110-31376132 CTCTCATTCTTCATCATAAAGGG - Intergenic
1022794054 7:33718026-33718048 ATGGTGTTCTCCTTAATAAAAGG - Intergenic
1022933181 7:35143705-35143727 CTGTTTTACTTCATAATAGTTGG - Intergenic
1023153025 7:37220232-37220254 ATGTTGTTCATCAAAATAAAGGG - Intronic
1024867290 7:53918723-53918745 CTCTTGCTCTTAATAACAAATGG - Intergenic
1028017596 7:85735199-85735221 ATGATTTTCTTCATTATAAATGG - Intergenic
1028822979 7:95233981-95234003 CTGATGGTTTTCATCATAAAGGG - Intronic
1029829103 7:103236471-103236493 CTGTTTTACTTCATAATAGTTGG - Intergenic
1030529355 7:110693838-110693860 TTGTTGTTGTTGTTAATAAAAGG + Intronic
1031059439 7:117033746-117033768 CTGTTGTACTTTATAATGGAGGG + Intronic
1032460320 7:132105450-132105472 CTGTTGTTGTTCTTATTGAAAGG - Intergenic
1032661945 7:133993824-133993846 CTTTTGTTTTTCCTGATAAAAGG - Intronic
1032741660 7:134745802-134745824 CAATTGTTCTTTATAATACAAGG + Intronic
1034226426 7:149487710-149487732 TAGTTGTTTTTCATTATAAATGG - Intronic
1035545035 8:473731-473753 CTCTTGTTCTTCCTAAGTAAGGG + Intergenic
1041148750 8:54909204-54909226 CTGTTTTTTTTCAGAATATAAGG + Intergenic
1042714125 8:71753611-71753633 AAGTTATTATTCATAATAAAAGG - Intergenic
1042907617 8:73788376-73788398 CTGTAGTTCTGAATAATAAAAGG + Intronic
1043693063 8:83181600-83181622 CTGTTGTCTTTAATAATAAGGGG + Intergenic
1043843737 8:85140252-85140274 CTGTTATTATTTATAATAATTGG - Intronic
1044195324 8:89369791-89369813 CTGTGCTTCTGGATAATAAAGGG + Intergenic
1044340886 8:91045011-91045033 CTGGTCTTTTTCATAAGAAATGG + Intergenic
1044389745 8:91636038-91636060 TTGTTGCTCTCCATAGTAAAAGG - Intergenic
1045927337 8:107588351-107588373 ATGATATTGTTCATAATAAAGGG + Intergenic
1046137633 8:110050258-110050280 CTTTTGTTCCTCATAATTAAGGG - Intergenic
1046563287 8:115866698-115866720 ATGTTATTCTACATCATAAAGGG + Intergenic
1048633573 8:136271203-136271225 ATGTTTGTCTTCTTAATAAAAGG - Intergenic
1050558505 9:6809589-6809611 CTGTGGTTGTTCATAAGGAATGG + Intronic
1050925669 9:11259837-11259859 CTGTTGTTTTTCATAACCCATGG - Intergenic
1052130509 9:24840425-24840447 CTGTTGCTCATCATTCTAAATGG + Intergenic
1054318327 9:63623724-63623746 CTGTTGTTGTTAAGAATATAAGG - Intergenic
1055661102 9:78504981-78505003 CTCTTGTTTTTCATAGGAAATGG - Intergenic
1056254264 9:84782583-84782605 CTGATGTTCTGCATACTTAATGG + Intronic
1056810387 9:89759304-89759326 CTATTTTGCTTCATAATCAATGG + Intergenic
1057507751 9:95649879-95649901 CTCTCATTCTTCTTAATAAATGG + Intergenic
1059036002 9:110754141-110754163 TTGTTTTTGTTCTTAATAAAAGG + Intronic
1059876631 9:118642374-118642396 CTGTTGTTCCTCAGCATATATGG + Intergenic
1060489931 9:124075674-124075696 ATGTTGTTTTTCATAAGAATTGG - Intergenic
1060654769 9:125363089-125363111 CTGTTCTTTTTTAAAATAAAAGG - Exonic
1061572283 9:131485178-131485200 CCGTTTTTCTTGATAATAAATGG - Intronic
1062743812 9:138198030-138198052 CTATTCTTCTTCAAAATAAAAGG + Intergenic
1185951746 X:4445138-4445160 CTATGGTACTTTATAATAAAAGG - Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1186127492 X:6429827-6429849 GTGTTGTTCTTCCTGATACAGGG + Intergenic
1186271000 X:7887988-7888010 CTGTTGTCTTTCAGAATAAAAGG - Intergenic
1186615091 X:11177806-11177828 CTGTTTTTCTTCTTTACAAACGG + Intronic
1188340686 X:28997662-28997684 CTGTTTATCTTAATAATAACTGG - Intronic
1188852907 X:35153546-35153568 GTCTCGATCTTCATAATAAAAGG - Intergenic
1189672405 X:43424914-43424936 CTGTGGTTCTTCATAATAGTAGG + Intergenic
1189949558 X:46214593-46214615 GTCATATTCTTCATAATAAATGG + Intergenic
1190041488 X:47075965-47075987 CTAATGTCCTTTATAATAAAAGG - Intergenic
1191663783 X:63677194-63677216 CTGTTGTTCTCCCCAATAAGAGG - Intronic
1192506940 X:71692338-71692360 CTCATGTTCTTCATAATAAATGG - Intergenic
1192512940 X:71736274-71736296 GTCATGTTCTTCATAATAAATGG + Intergenic
1192513757 X:71745235-71745257 GTCATGTTCTTCATAATAAATGG - Intergenic
1192519757 X:71789208-71789230 CTCATGTTCTTCATAATAAATGG + Intergenic
1192526449 X:71849161-71849183 GTCATGTTCTTCATAATAAATGG - Intergenic
1193576582 X:83205973-83205995 CTGTTGCTCTTAAAAATTAAAGG - Intergenic
1193609714 X:83615274-83615296 ATTTTGTTCTTCATCATAGAAGG - Intergenic
1193923687 X:87460717-87460739 ATCTAGTTCTTCATAATCAAAGG + Intergenic
1194488898 X:94522357-94522379 ATTTTGGTCTTCATAATATAGGG - Intergenic
1195377797 X:104244573-104244595 CTGTTGTGCTTCACAAACAAGGG - Intergenic
1196890612 X:120287279-120287301 GTGTTGTACTTGGTAATAAAAGG + Intronic
1198216774 X:134562736-134562758 CTGTTGTTCTTCACTTGAAATGG + Intergenic
1198440184 X:136655596-136655618 CTGTTGTTCTGGATACTAAATGG + Intronic
1199239886 X:145534183-145534205 CTGTAATTCTTGATAAGAAAAGG - Intergenic
1199375069 X:147098458-147098480 TTATTGTTCTTCCTAAAAAATGG - Intergenic
1200568629 Y:4800783-4800805 CTGTTGTTCTATCTAATACAAGG - Intergenic
1201756554 Y:17492879-17492901 GTCTTCTTCTTCAAAATAAAAGG - Intergenic
1201844998 Y:18413106-18413128 GTCTTCTTCTTCAAAATAAAAGG + Intergenic