ID: 915185825

View in Genome Browser
Species Human (GRCh38)
Location 1:154104529-154104551
Sequence CTGGGGAGTACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915185819_915185825 7 Left 915185819 1:154104499-154104521 CCACATGGGGCAGAGAGAGAATC 0: 1
1: 8
2: 21
3: 63
4: 333
Right 915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG 0: 1
1: 0
2: 0
3: 19
4: 202
915185813_915185825 30 Left 915185813 1:154104476-154104498 CCTTTCCCAGGCAGTGGCAGCAG 0: 1
1: 0
2: 9
3: 46
4: 488
Right 915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG 0: 1
1: 0
2: 0
3: 19
4: 202
915185814_915185825 25 Left 915185814 1:154104481-154104503 CCCAGGCAGTGGCAGCAGCCACA 0: 1
1: 0
2: 2
3: 40
4: 446
Right 915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG 0: 1
1: 0
2: 0
3: 19
4: 202
915185815_915185825 24 Left 915185815 1:154104482-154104504 CCAGGCAGTGGCAGCAGCCACAT 0: 1
1: 0
2: 6
3: 147
4: 589
Right 915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG 0: 1
1: 0
2: 0
3: 19
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915185825 Original CRISPR CTGGGGAGTACAGTGATTGT GGG Intronic
903292568 1:22324082-22324104 CTGGGAAGCACAGTGAGTATGGG - Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906321975 1:44822737-44822759 CTGGGGATTACCATGACTGTTGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908554891 1:65248082-65248104 CTGGAGCGAGCAGTGATTGTGGG + Intergenic
909434386 1:75623903-75623925 CTATGGAGTACATTGCTTGTAGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911459766 1:98174519-98174541 CTGCTGAGTCCAGTTATTGTTGG + Intergenic
912020798 1:105107300-105107322 CTGGGGACTAAACTGACTGTAGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
915100532 1:153495778-153495800 CTGGGGAGCCCAGAGGTTGTAGG - Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917186399 1:172361470-172361492 CAGGGGAGTTAAGTGATTGAAGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
922073025 1:222215214-222215236 CTGGGCAGGACAATCATTGTAGG - Intergenic
923228968 1:231965731-231965753 CTGTGGAGCACAGTTAATGTAGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065637054 10:27743725-27743747 CTGGGGAGTGAAGGGATTGGGGG - Intronic
1068353510 10:55880965-55880987 CTAGAGAGTATAGTGAGTGTTGG - Intergenic
1069006221 10:63320466-63320488 ATGGGGCTGACAGTGATTGTGGG - Intronic
1070449995 10:76548531-76548553 CTGGGGAGGAGAGGGGTTGTTGG + Intronic
1071778322 10:88813976-88813998 ATGGGGATTACAGGGATTATGGG + Intronic
1074408971 10:113207647-113207669 CTGGGAAGTATAGTGTGTGTTGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075228238 10:120648989-120649011 CTGGGGAGTTTAGTGATCCTGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076242795 10:128922450-128922472 TTGGAGAATACAGTGATTCTGGG - Intergenic
1076743861 10:132502939-132502961 GTGGGCAGTTCAGTGGTTGTTGG - Intergenic
1077648162 11:3944998-3945020 CTGGTGAGTACTGTGATAGAGGG - Intronic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1080455938 11:32419363-32419385 CTGGGGAATACAATGCCTGTTGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083734580 11:64672142-64672164 CTGGGGAGTACAGTGGGGGCTGG - Intronic
1085264807 11:75230934-75230956 CTGGCCAGTACATTGATTATTGG - Intergenic
1085727371 11:78965809-78965831 CTGTGAAGTACAGTTATTATTGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090447266 11:126775099-126775121 CTGGGGAGTTCGGTATTTGTTGG - Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1094226251 12:28049423-28049445 CTGGAGAGTGGAGTGATTTTTGG + Intergenic
1096206955 12:49730853-49730875 CTGGGTAGTCCAATGATTTTGGG - Intronic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1102589991 12:113949787-113949809 CTGGGGAGGGCAGGGATTGGAGG - Intronic
1103381535 12:120497316-120497338 CTGGGGAGTAGAATGCCTGTGGG - Intronic
1105788758 13:23776074-23776096 ATGGGGGGTACAGAGATTGAAGG - Intronic
1106824568 13:33506043-33506065 CTGAAGAGTACAGTGACTATGGG - Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1110087998 13:71406691-71406713 ATGGGGATTATAGGGATTGTAGG - Intergenic
1110329706 13:74257364-74257386 CTGGAGAGTACAGGGACTCTCGG - Intergenic
1112300566 13:98225928-98225950 TTGGGGAGGTCAGTGATGGTTGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116541806 14:46109268-46109290 CTGAAGAGCACAATGATTGTGGG + Intergenic
1118046656 14:61977620-61977642 ATGGGGATTACAGGGATTATGGG + Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1120947857 14:90014949-90014971 CTGGGGAGTGGAGTACTTGTTGG - Intronic
1121069878 14:91008967-91008989 CTGAGCATTACAGTGATTCTTGG - Intronic
1122130426 14:99602004-99602026 CTGGGGAGGGCAGTTATTGCAGG + Intronic
1122565765 14:102654500-102654522 CTAGGGAGTAGTGTGTTTGTTGG + Intronic
1124592737 15:31067834-31067856 CTGGGTGGTACATTGATTATCGG + Intronic
1124660912 15:31550225-31550247 CTGGGGGATACAGTCATTATTGG - Intronic
1124867305 15:33505038-33505060 CTGGAGAGTACACTGTCTGTGGG + Intronic
1126486648 15:49188430-49188452 TGGAGGAGTACAGTGATTATGGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1127938604 15:63669657-63669679 GTGGGAAGTACAGTGGTAGTTGG + Exonic
1131385094 15:91999123-91999145 CTGGGGACTACAGTGGGGGTAGG + Intronic
1135109228 16:19677764-19677786 CTGGGGAAAACAGAGATAGTGGG - Intronic
1136296702 16:29308054-29308076 CTGGGGAGGACAGAGGTGGTGGG + Intergenic
1138647211 16:58434279-58434301 CTGGGCAGCACAGTAATTATGGG - Intergenic
1142489063 17:266271-266293 CTGGGGAGCACAGGGATGATGGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144566661 17:16365103-16365125 CTGGTGAGTTCAGTGGATGTGGG - Intergenic
1145183977 17:20778521-20778543 ATGGGGATTATAGTGATTATGGG - Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158003694 18:52647849-52647871 CTGGGGAGTAGAGTGTGTGCTGG + Intronic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1162173778 19:8813910-8813932 CTTGGGAGTACAGTGATGAATGG - Intronic
1162433852 19:10644859-10644881 CTGGGGAGCATAGTGACTGCAGG - Intergenic
1163842574 19:19620269-19620291 CTGGGCAGTGCTGTGCTTGTGGG - Intergenic
1163998439 19:21074847-21074869 CTGAGGAGTGAAGTGCTTGTAGG - Intergenic
1164973235 19:32550235-32550257 CTGGGGAGAGCAGAGTTTGTGGG - Intergenic
1168673889 19:58262750-58262772 CTTAGGAGTGCAGTCATTGTGGG + Exonic
926436560 2:12844409-12844431 CTTGGCTGCACAGTGATTGTGGG - Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
932398794 2:71465906-71465928 CTAGGGAGTGTAGAGATTGTTGG + Intronic
934855858 2:97729485-97729507 GTGGGGAGTGCTGTGATTATAGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935804672 2:106733898-106733920 GTGGGAAGTACACTGAATGTGGG + Intergenic
937064324 2:119005866-119005888 CTGGGCAGGACAGAGATGGTAGG + Intergenic
937079603 2:119130987-119131009 CTGGGCAGTGCAGTGTTTGTAGG - Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
943698222 2:190959678-190959700 TTGGTGAGGACAGTGATTGCTGG + Intronic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945818133 2:214630579-214630601 CTGGGGATTATAGGGATTATGGG + Intergenic
946993654 2:225365256-225365278 CTGGGGATTACATTGATTCTAGG + Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1172130212 20:32650323-32650345 CTGGGGAGCAGAATGATTGTGGG + Intergenic
1173024252 20:39293286-39293308 CTGGGAAGTACAGGGAATGAGGG + Intergenic
1173045810 20:39510051-39510073 GTGGGGATTACATTGATTTTTGG - Intergenic
1175184981 20:57173959-57173981 CTGAGGAGTATATTGATTATTGG - Intronic
1182622156 22:31624099-31624121 CTGGGGAGGACTGGGAATGTGGG + Intronic
952019171 3:28996562-28996584 CTGGGGACTATAGAGATGGTAGG + Intergenic
952068941 3:29609406-29609428 CTGGATTGTACAGTGATTCTGGG + Intronic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
954882046 3:53843141-53843163 CTGGGGATTACCGTGACTCTTGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955868442 3:63410832-63410854 TTGAGGAGGACAGTGATGGTTGG + Intronic
956445202 3:69319336-69319358 ATGGGGACTACAATAATTGTGGG - Intronic
957140440 3:76348267-76348289 CTGGGGAGGCAAGTAATTGTTGG + Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
961044194 3:123697636-123697658 GTGGACAGTACAGTCATTGTTGG + Intronic
962282714 3:134064372-134064394 GTGGGGAGCACAGTCATGGTGGG + Intergenic
963006131 3:140727627-140727649 CTGGGGAAAACAGTGATTCTTGG - Intergenic
963921971 3:150914426-150914448 CTGGGGGCTGCAGTGGTTGTGGG + Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
969442318 4:7224681-7224703 CTGGGGAATACAGTGAGGCTTGG + Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974022351 4:56703187-56703209 CTGGGGAGTATAGGGAATTTTGG - Intergenic
974594330 4:63996989-63997011 CTGAGCTGCACAGTGATTGTGGG - Intergenic
974877136 4:67714582-67714604 ATGGTGGGGACAGTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984150826 4:176127754-176127776 CTGATGAGTACAGGGTTTGTTGG - Intronic
985711404 5:1431700-1431722 CTGGGGTGGACAGTGAGGGTTGG + Intronic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986187075 5:5454037-5454059 CTGGGGAGTTCAGGGATTACAGG - Intronic
991559410 5:67933622-67933644 CTGAGCATTACAGTGATAGTAGG - Intergenic
992781514 5:80132360-80132382 CTAAGGAGTACAGTGCTTCTTGG - Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994545089 5:101155934-101155956 GTGGGGAATACAGGGATTATGGG + Intergenic
997819508 5:137051926-137051948 CTGGGGAGTACAGAGTTTTCAGG - Intronic
998266223 5:140669635-140669657 CTGGGGATGACAGTGACTGAAGG + Exonic
1000980891 5:167815662-167815684 CTAGGGAGGACAGTCACTGTGGG - Intronic
1002971925 6:2031745-2031767 CTGAGGAGCAGAGTGACTGTGGG + Intronic
1004989971 6:21125865-21125887 CGGGGAAGCACAGAGATTGTGGG - Intronic
1007652848 6:43433916-43433938 CTGGGTTCTGCAGTGATTGTGGG + Intronic
1007882833 6:45186253-45186275 CTTGGGATGACAGTGATTTTTGG - Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011359814 6:86511371-86511393 AGGGGGAGAACAGTAATTGTGGG - Intergenic
1013881698 6:114910627-114910649 TTAGGGAGTGCAGTGATTCTGGG - Intergenic
1014356746 6:120420962-120420984 GTGGGGATTACAGTCATTATGGG + Intergenic
1014436363 6:121425093-121425115 GTGGGGATTACAGGGATTATGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016935802 6:149448760-149448782 CTGGGGCATACAGTGATGTTAGG - Intronic
1018066631 6:160129112-160129134 CTGGGGAGAACAGAGGGTGTTGG - Intronic
1020726441 7:11820664-11820686 CTGGGGACTAAAGTCTTTGTGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1024725383 7:52188959-52188981 CTGGGCAGTTCAGGGAGTGTGGG + Intergenic
1025908835 7:65811118-65811140 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1025980033 7:66397810-66397832 CAGGAGAGTACTGTGAATGTGGG - Intronic
1026043502 7:66888322-66888344 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1026399637 7:69996550-69996572 GTGGGGAGGACAGTGTTTGTAGG - Intronic
1027204909 7:76090149-76090171 CAGGAGAGTACTGTGAATGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1033283419 7:140021723-140021745 GTGGGGAGGTCAGGGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035156324 7:156916563-156916585 CTGGGGAGTTCTGTGATTGCTGG + Intergenic
1035417239 7:158699966-158699988 CTGCAGAGTGCAGTGACTGTTGG + Intronic
1036756556 8:11475102-11475124 CTGGGCAGTCCAGTGGTTGCAGG + Intergenic
1038067273 8:23975996-23976018 CTGGAGAGGACAGTGTTTGTGGG + Intergenic
1041982075 8:63873612-63873634 GTGGGGAGGAGAGTGACTGTGGG - Intergenic
1042965206 8:74344033-74344055 GTGGGGGGTACAGTGCTTCTTGG + Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047248897 8:123166852-123166874 CTGGGGAGTACAGGGCTGGGAGG - Intergenic
1048070042 8:131011784-131011806 CTGGGGGGTAGAGTCAGTGTTGG - Intronic
1048906330 8:139092860-139092882 CTGGGGAGATCAGGAATTGTGGG + Intergenic
1050364181 9:4858941-4858963 CTGGGGAGTACAGGGCCTGGTGG + Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053006247 9:34606685-34606707 ATGTGGAGTACAGAGAGTGTTGG - Intergenic
1057566386 9:96169314-96169336 CTGGGGAGTAGGGGGATCGTGGG + Intergenic
1058659162 9:107253176-107253198 CTGTCGAGGACCGTGATTGTAGG + Intergenic
1058674429 9:107388372-107388394 CTGAGGAGTAGAGTTATAGTTGG + Intergenic
1058962990 9:110009178-110009200 CTGGTGATTACAGGGAGTGTGGG + Intronic
1059536084 9:115082236-115082258 CAGAGGAGTAGGGTGATTGTTGG + Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060299424 9:122366229-122366251 CTGCGGATTACACTGATGGTGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188748382 X:33874632-33874654 CTGTGTAGTACTGTAATTGTAGG + Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1189024927 X:37384205-37384227 CAGGGCAGTTCAGTGATAGTAGG - Intronic
1191611652 X:63121833-63121855 CTGGGGAAATCAGTGGTTGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195937981 X:110143429-110143451 CTGGGGTCTACAGTGATACTTGG + Intronic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1198110087 X:133495345-133495367 CTGAGGAGTACAGTTTTTCTCGG - Intergenic
1201432425 Y:13917467-13917489 CTGTGGAGTACAGTGATTTCTGG - Intergenic