ID: 915187610

View in Genome Browser
Species Human (GRCh38)
Location 1:154120390-154120412
Sequence CACCGTATGCTCTCACTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25749
Summary {0: 3, 1: 158, 2: 5601, 3: 13584, 4: 6403}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915187607_915187610 18 Left 915187607 1:154120349-154120371 CCATCATTCTCAGCAAACTATCA 0: 3456
1: 11192
2: 10129
3: 4750
4: 3607
Right 915187610 1:154120390-154120412 CACCGTATGCTCTCACTCATAGG 0: 3
1: 158
2: 5601
3: 13584
4: 6403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915187610 Original CRISPR CACCGTATGCTCTCACTCAT AGG Intronic