ID: 915187610 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:154120390-154120412 |
Sequence | CACCGTATGCTCTCACTCAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 25749 | |||
Summary | {0: 3, 1: 158, 2: 5601, 3: 13584, 4: 6403} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
915187607_915187610 | 18 | Left | 915187607 | 1:154120349-154120371 | CCATCATTCTCAGCAAACTATCA | 0: 3456 1: 11192 2: 10129 3: 4750 4: 3607 |
||
Right | 915187610 | 1:154120390-154120412 | CACCGTATGCTCTCACTCATAGG | 0: 3 1: 158 2: 5601 3: 13584 4: 6403 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
915187610 | Original CRISPR | CACCGTATGCTCTCACTCAT AGG | Intronic | ||