ID: 915190111

View in Genome Browser
Species Human (GRCh38)
Location 1:154142805-154142827
Sequence AACCTCTGCCCTCCCGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1817
Summary {0: 1, 1: 0, 2: 4, 3: 126, 4: 1686}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915190111_915190113 16 Left 915190111 1:154142805-154142827 CCTGAAGCGGGAGGGCAGAGGTT 0: 1
1: 0
2: 4
3: 126
4: 1686
Right 915190113 1:154142844-154142866 GCACCACTGCACTTGAGCCTAGG 0: 44
1: 1765
2: 54219
3: 144259
4: 212580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915190111 Original CRISPR AACCTCTGCCCTCCCGCTTC AGG (reversed) Intronic
900570700 1:3356896-3356918 AGACTCGGCCCTCCCGCTGCCGG - Intronic
900624390 1:3601507-3601529 AACCTCAGCCCTCCTGGTACTGG + Intronic
900778960 1:4604997-4605019 AAACTCTGGGCTCCTGCTTCTGG + Intergenic
901065855 1:6494210-6494232 AACCTCTGCCTCCCAGGTTCAGG + Intronic
901076560 1:6558798-6558820 AACCTCTGCCTCCCAGATTCAGG + Intronic
901092019 1:6648235-6648257 AACCTCTGCCTCCCGGGTTCAGG + Intronic
901297691 1:8173258-8173280 AACCTCCGCCTTCCAGGTTCAGG + Intergenic
901503200 1:9666784-9666806 AACCTCTGCCTCCCGGGTTCAGG + Intronic
901537477 1:9891881-9891903 AACCTCTGCCTTCCAGTCTCAGG + Intronic
901545823 1:9956249-9956271 AACCTCTGCCTCCCAGGTTCAGG + Intronic
901678325 1:10899490-10899512 AACCTCTGCCTCCCGGATTCAGG - Intergenic
901845496 1:11979782-11979804 AACCTCTCCTCTCCCTCTCCTGG + Intergenic
901851839 1:12020763-12020785 AACCTCTGCCTCCCGGGTTCAGG + Intronic
901901149 1:12363869-12363891 AACCTCCGCCTCCCCGATTCAGG - Intronic
902223615 1:14982509-14982531 AACCTCTGCCTCCCAGGTTCAGG + Intronic
902714413 1:18262611-18262633 GACCTCTCTCATCCCGCTTCTGG - Intronic
902745919 1:18474243-18474265 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
902795389 1:18797518-18797540 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
902938771 1:19784450-19784472 AACCTCTGCCTCCCAGATTCAGG - Intronic
903206777 1:21788395-21788417 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
903401053 1:23049068-23049090 AACCTCTGCCTTCTGGGTTCAGG - Intronic
903937168 1:26904247-26904269 AACCTCTGCCTGCCGGGTTCAGG + Intronic
904100394 1:28021683-28021705 AACCTCTGCCTCCCTGGTTCAGG + Intronic
904118615 1:28180296-28180318 AACCTCTGCCTCCCGGGTTCAGG - Intronic
904168703 1:28575940-28575962 AACCTCTGCCTCCCGGGTTCAGG + Intronic
904174894 1:28620213-28620235 AACCTCTGCCTCCCGGGTTCAGG + Intronic
904312434 1:29637707-29637729 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
904552538 1:31331691-31331713 AACCTCTGCCTCCCAGGTTCAGG + Intronic
904561522 1:31401124-31401146 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
904658288 1:32065826-32065848 AACCTCTGCCTTCCGGGTTCAGG - Intergenic
904788793 1:33002338-33002360 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
904949319 1:34223547-34223569 AACCTCTGCCTCCCGGGTTCGGG + Intergenic
905052827 1:35067058-35067080 AACCTCTGCCTCCCGGGTTCAGG + Intronic
905055058 1:35086384-35086406 AACCTCTGCCTCCCAGGTTCAGG + Intronic
905128225 1:35731116-35731138 AACCTCTGCCTCCCGGGTTCAGG - Intronic
905295158 1:36949654-36949676 AACCTCTGCCTCCCAGGTTCAGG + Intronic
905364877 1:37445387-37445409 AACCTCTGCCTCCCTGGTTCAGG + Intergenic
905563981 1:38948612-38948634 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
905640502 1:39586380-39586402 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
905654133 1:39675155-39675177 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
905784951 1:40747915-40747937 AACCTCTGCCTCCCAGGTTCAGG + Intronic
905838339 1:41150419-41150441 AACTTCTGCCTCCCGGCTTCAGG - Intronic
906192658 1:43907999-43908021 AACCTCTGCCCTCCCTTTAAAGG + Intronic
906327243 1:44854667-44854689 AACCTCTGCCTTCCAGGTTCAGG + Intronic
906434659 1:45785156-45785178 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
906489087 1:46254054-46254076 AACCTCTGCCTCCCAGGTTCAGG + Intronic
906491232 1:46270285-46270307 AACCTCTGCCTCCCAGGTTCAGG - Intronic
906497831 1:46318138-46318160 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
906924007 1:50094846-50094868 AACCTCTGCCTCCCGGGTTCAGG - Intronic
907111210 1:51928186-51928208 AACCTCCGCCTCCCCGGTTCAGG + Intronic
907116108 1:51969986-51970008 AACCTCTGCCTCCTGGCTTCAGG - Intronic
907128420 1:52073200-52073222 AACCTCTGCCTCCCAGGTTCAGG - Intronic
907154051 1:52316081-52316103 AACCTCTGCCTTCTGGGTTCAGG - Intronic
907164483 1:52398343-52398365 AACCTCTGCCTCCCTGGTTCAGG + Intronic
907250400 1:53134300-53134322 ATCCTCTACCCTCCTGGTTCCGG + Intronic
907313923 1:53555446-53555468 AACCTCTGCCTCCCGGGTTCAGG - Intronic
907501713 1:54886290-54886312 AGGTTCTTCCCTCCCGCTTCTGG + Intronic
907513180 1:54977573-54977595 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
907539618 1:55201517-55201539 AACCTCTGCCTTCCGGGTTCAGG - Intronic
908196488 1:61750515-61750537 AACCTCTGCCTCCCGGGTTCGGG + Intronic
908196707 1:61752054-61752076 AACCTCTGCCTCCCGGGTTCAGG - Intronic
908270935 1:62422170-62422192 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
908342374 1:63194769-63194791 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
908525778 1:64986185-64986207 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
908739341 1:67310804-67310826 AACCTCTGCCTCCCGGGTTCAGG + Intronic
909276752 1:73696531-73696553 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
909613045 1:77573199-77573221 AACCTCTGCCTCCCGGGTTCAGG + Intronic
909741491 1:79035545-79035567 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
909888499 1:80973017-80973039 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
909926293 1:81441604-81441626 AACCTCTGCCTCCCAGGTTCAGG + Intronic
909942842 1:81631296-81631318 AACCTCTGCCTCCCCTGTTCAGG + Intronic
911437704 1:97883526-97883548 AACCTCTGCCTTCCAGGCTCAGG + Intronic
911608856 1:99938692-99938714 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
912047178 1:105473452-105473474 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
912136428 1:106664802-106664824 AACCTCTGCCTCCCAGATTCAGG - Intergenic
912857430 1:113182591-113182613 AAACTCTGCCCCCCAGGTTCAGG + Intergenic
912882928 1:113436894-113436916 AACCTCTGCCTCCCAGGTTCAGG + Intronic
912990489 1:114481507-114481529 AACCTCTGCCACCCAGATTCAGG - Intronic
913004032 1:114610616-114610638 AACCTCTGCCTCCCGGGTTCAGG - Intronic
913029389 1:114883772-114883794 AACCTCCGCCTTCCTGGTTCAGG + Intronic
913278991 1:117167009-117167031 AGCCTCTGCCTCCCAGCTTCAGG - Intronic
914004017 1:143717162-143717184 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
914229624 1:145753796-145753818 AACCTCTGCCTCCCAGGTTCAGG + Intronic
914358687 1:146911260-146911282 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
914788473 1:150854773-150854795 AACCTCTGCCTCCCGGGTTCAGG - Intronic
914881971 1:151554479-151554501 AACCTCTGCCTCCCGGGTTCAGG + Intronic
915157796 1:153892774-153892796 AACCTCTGCCTCCCGGGTTCGGG + Intronic
915159793 1:153909864-153909886 AACCTCTGCCTCCCAGGTTCAGG - Intronic
915190111 1:154142805-154142827 AACCTCTGCCCTCCCGCTTCAGG - Intronic
915221986 1:154381974-154381996 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
915426250 1:155829516-155829538 AACCTCTGCCTCCCCGGTTCAGG - Intronic
915432123 1:155874806-155874828 AACCTCTGCCTCCCGGGTTCAGG - Intronic
915442723 1:155955795-155955817 AACCTCTGCCTCCCAGGTTCAGG + Intronic
915474372 1:156144558-156144580 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
915818109 1:158991794-158991816 AACCTCTGCCTTCCAGATTCAGG - Intergenic
915959207 1:160250382-160250404 AACCTCCGCCTTCCAGGTTCAGG - Intronic
915972884 1:160366733-160366755 AGCCTCTGCCCTGCTGCCTCTGG + Intergenic
916090111 1:161301339-161301361 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
916233612 1:162563444-162563466 AACCTCCGCCTCCCCGGTTCAGG + Intronic
916617759 1:166460298-166460320 AATCTCTGCCTTCCAGGTTCAGG + Intergenic
916642246 1:166742885-166742907 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
916787534 1:168097283-168097305 AACCGCTGCCTTCCTGCGTCAGG + Intronic
917428163 1:174937364-174937386 AACCTCTGCCTCCCTGGTTCAGG + Intronic
917604448 1:176612310-176612332 AACCTCTGCCTCCCAGATTCAGG - Intronic
917760788 1:178154903-178154925 AACCTCTGCCTTCCGGGTTCAGG + Intronic
917875433 1:179282710-179282732 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
918129767 1:181616630-181616652 AACCTCTGCCTCCCCAGTTCAGG - Intronic
918217401 1:182404362-182404384 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
918345422 1:183603585-183603607 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
918525031 1:185455879-185455901 AACCTCTGCCTCCCGGGTTCGGG + Intergenic
918677187 1:187302112-187302134 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
919204951 1:194409936-194409958 AACCTCTGCCTCCCAGGTTCTGG + Intergenic
919628404 1:199935378-199935400 AACCTCTGCCTCCCTGGTTCAGG + Intergenic
919674471 1:200367550-200367572 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
919701276 1:200633373-200633395 AACCTCTGCCTCCCAGATTCAGG - Intronic
919715629 1:200773333-200773355 AACCTCTGCCTCCCAGGTTCAGG + Intronic
919888301 1:201951030-201951052 AACCTTTGCCTCCCAGCTTCAGG - Intergenic
919944348 1:202308678-202308700 AAGCCCTGCCCACCCGCTTGGGG - Intronic
920157206 1:203963161-203963183 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
920233567 1:204486646-204486668 AACCTCTGTCCTCCAGGATCAGG - Intronic
920241241 1:204552402-204552424 AACCTCTGCCTCCCGGGTTCAGG + Exonic
920269782 1:204754378-204754400 AACCTCTGCCTGCCAGGTTCAGG + Intergenic
920677022 1:208045182-208045204 AACCTCTGCCCTCCTGCCTCTGG - Exonic
920768233 1:208854025-208854047 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
920828217 1:209442217-209442239 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
920998368 1:211016825-211016847 AACCTCTGCCTCCCAGGTTCAGG - Intronic
921080229 1:211733221-211733243 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
921567051 1:216733905-216733927 AACCTCTGCCTCCCTGGTTCAGG - Intronic
921635484 1:217487505-217487527 AACCTCCGCCTTCCGGGTTCAGG + Intronic
921969957 1:221137203-221137225 AACCTCTGCCTCCCGGATTCAGG + Intergenic
922254665 1:223883274-223883296 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
922309061 1:224370956-224370978 AACCTCTGCCTTCCGGGTTCAGG + Intronic
922487733 1:225988645-225988667 AACCTCTGCCCCCCAGGTTCAGG - Intronic
922617491 1:226971020-226971042 AACCTCTGCCTCCCGGGTTCAGG + Intronic
922699480 1:227750544-227750566 GCCCTCTGCCCTCCCGCCTGTGG + Intronic
922926501 1:229351185-229351207 AACCTCTGCCTACCAGGTTCAGG - Intergenic
923033228 1:230266110-230266132 AACCTCTGCCTCCCGGGTTCAGG - Intronic
923110574 1:230886675-230886697 AACCTCTGCCTCCCTGGTTCAGG + Intergenic
923164303 1:231345201-231345223 AACCTCTGCCTCCCAGGTTCAGG + Intronic
923246938 1:232141271-232141293 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
923592953 1:235336307-235336329 AACCTCTGCCTTCCAGGTTCAGG - Intronic
923612643 1:235509081-235509103 AACCTCTGCCTCCCAGTTTCAGG + Intergenic
923819963 1:237427699-237427721 AACCTCTGCCTCCCAGGTTCAGG - Intronic
923830914 1:237556379-237556401 AACCTCTGCCTCCCTGGTTCAGG + Intronic
923872183 1:238007739-238007761 AACCTCTGCCCCCCGGGATCAGG + Intergenic
924097964 1:240573999-240574021 AACCTCTGCCTCCCAGGTTCAGG + Intronic
924212215 1:241782204-241782226 AACCTCTGCCTCCTGGCTTCAGG - Intronic
924230825 1:241960414-241960436 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
924248146 1:242105303-242105325 AACCTCTGCCTCCCAGGTTCAGG + Intronic
924248853 1:242110726-242110748 AACCTCTGCCTCCCAGGTTCAGG - Intronic
924307181 1:242701915-242701937 CACCACTGCCCTCCAGCTTTGGG - Intergenic
924440093 1:244078771-244078793 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
924504585 1:244669594-244669616 AACCTCTGCCTCCCGGGTTCAGG - Intronic
924549680 1:245063801-245063823 AACCTCTGCCTCCTGGCTTCAGG + Intronic
924594241 1:245431424-245431446 AACCTCTGCCTCCCGGCTTCAGG + Intronic
924746122 1:246835044-246835066 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
924746787 1:246842498-246842520 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1062818049 10:515640-515662 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1062870218 10:895102-895124 AACCTCTGCCTCCCGGATTCAGG - Intronic
1062887217 10:1026189-1026211 AACCTCTGCCTCCCGGGTTCGGG + Intergenic
1063111119 10:3038209-3038231 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1063274406 10:4549112-4549134 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1063385392 10:5613368-5613390 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1063427413 10:5960993-5961015 AACCTCTGCCTTCCGGGTTCAGG + Intronic
1063751603 10:8954970-8954992 AACCTCTGCCCCCTGGGTTCAGG - Intergenic
1063827681 10:9916677-9916699 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1063850667 10:10186217-10186239 AACCTCCACCCTCCTGGTTCAGG - Intergenic
1063900587 10:10728369-10728391 AACCTCTGCCTCCTGGCTTCAGG - Intergenic
1064033450 10:11897710-11897732 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1064079379 10:12296009-12296031 AACCTCTGCCTTCCGGGTTCAGG - Intergenic
1064128178 10:12683001-12683023 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1064438469 10:15332029-15332051 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1064459875 10:15523848-15523870 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1064639209 10:17398243-17398265 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1064737170 10:18394021-18394043 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1064787489 10:18914895-18914917 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1064830070 10:19453792-19453814 AACCTCTGCCTCCCTGGTTCAGG - Intronic
1064995367 10:21291822-21291844 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1065026333 10:21542486-21542508 AACCTCTGCCTCCCGGGTTCGGG - Intronic
1065501114 10:26383580-26383602 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1065514835 10:26514951-26514973 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1065548896 10:26850574-26850596 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1065628988 10:27658710-27658732 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1065729460 10:28697536-28697558 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1065994836 10:31048615-31048637 AACCTCCGCCTCCCGGCTTCAGG + Intergenic
1066375533 10:34855004-34855026 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1066375558 10:34855175-34855197 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1066387943 10:34956627-34956649 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1066666419 10:37787195-37787217 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1067139921 10:43648522-43648544 AGACGCTGCCCTCCCGCCTCAGG + Intronic
1067174887 10:43938701-43938723 AACCTCCGCCTTCCAGGTTCGGG - Intergenic
1067196223 10:44121606-44121628 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1067217337 10:44314066-44314088 GACATGTGCCCTCCCACTTCTGG - Intergenic
1067227303 10:44384574-44384596 ACCCACTGCCTTCCCGCTGCGGG - Intronic
1067289264 10:44929521-44929543 AGCCTCCACCCTCCCGCCTCAGG + Intronic
1067396256 10:45922108-45922130 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1067406869 10:46031180-46031202 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1067779689 10:49190680-49190702 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1067864575 10:49891230-49891252 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1067895616 10:50176186-50176208 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1068072907 10:52218128-52218150 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1068176191 10:53462532-53462554 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1068424624 10:56843703-56843725 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1068864391 10:61879755-61879777 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1068979257 10:63044150-63044172 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1069086894 10:64151123-64151145 ACCCTCTGCCCACCAGCCTCTGG + Intergenic
1069297806 10:66868667-66868689 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1069399425 10:68026759-68026781 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1069455568 10:68551363-68551385 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1069506070 10:68999177-68999199 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1069536303 10:69255833-69255855 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1069568670 10:69480777-69480799 AACCTCTGCCTCCCTGGTTCAGG + Intronic
1070061139 10:72984053-72984075 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1070189241 10:74096278-74096300 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1070205377 10:74253846-74253868 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1070248258 10:74751719-74751741 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1070306588 10:75243227-75243249 AACCTCTGCCTTCTGGGTTCAGG + Intergenic
1070429022 10:76317653-76317675 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1070764058 10:79046351-79046373 ACCCTCTGCCTTCCAGATTCAGG - Intergenic
1070914858 10:80146739-80146761 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1071269652 10:83995426-83995448 AACCTCTGCCTCCCCAGTTCAGG + Intergenic
1071385819 10:85120338-85120360 AACCTCTGCCTTCTGGGTTCAGG + Intergenic
1071552324 10:86576049-86576071 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1071553854 10:86587249-86587271 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1071690053 10:87808466-87808488 AACCTCTGCCTCCCGGCTTCAGG - Intronic
1071695797 10:87869305-87869327 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1071696474 10:87879405-87879427 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1071697542 10:87892719-87892741 AATCTCTGCCCACTCACTTCTGG - Intronic
1071699471 10:87914971-87914993 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1071920643 10:90346117-90346139 AACATCTGCTCTCCTGGTTCTGG + Intergenic
1072088034 10:92099780-92099802 AACCTCTGCCTCCCAGATTCAGG - Intronic
1072227665 10:93385197-93385219 AACCTCTGCCCTGCCACTAAAGG - Intronic
1072349639 10:94544685-94544707 AACCTCTGCCGCCCAGGTTCAGG + Intronic
1072475714 10:95757921-95757943 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1072490954 10:95905739-95905761 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1072651416 10:97298794-97298816 AACCTCTGCCTTTCAGGTTCAGG + Intergenic
1072682389 10:97516691-97516713 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1072736325 10:97881954-97881976 AGCCCCTGCCCTCCCCCATCTGG + Intronic
1072900352 10:99401583-99401605 AACCTCCGCCTCCCGGCTTCAGG - Intronic
1073091709 10:100946406-100946428 AGCCTCTGCCTTCCGGATTCAGG + Intronic
1073163153 10:101419090-101419112 AACCTCTGCCTCCCAGGTTCTGG + Intronic
1073170315 10:101501109-101501131 AACCTCTGCCCCGCAGGTTCAGG - Intronic
1073234860 10:102005299-102005321 AACCTCTGCCTCCCAGATTCAGG - Intronic
1073315639 10:102578787-102578809 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1073407400 10:103310031-103310053 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1073696556 10:105876318-105876340 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1073775379 10:106779630-106779652 AACCTCTGCCCTCTGCCTCCTGG + Intronic
1074134504 10:110615039-110615061 AACCCCAGCCCTCCAGCTTGGGG - Intergenic
1074319775 10:112391286-112391308 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1074393493 10:113077779-113077801 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1074435136 10:113427260-113427282 AACCTCCGCCCTCCTCCTCCTGG - Intergenic
1074494993 10:113972279-113972301 CACCACTGCCCTCCAGCTTGGGG + Intergenic
1074666945 10:115738218-115738240 AACCTCTGCCTCCCAGATTCAGG + Intronic
1074808285 10:117076099-117076121 AACCTCTGCCTTCCAGGCTCAGG - Intronic
1076009447 10:126975704-126975726 AACCTCTGCCTCCCTGGTTCAGG + Intronic
1076701933 10:132277794-132277816 AACCTCTGCCTTCAGGCTGCAGG + Intronic
1077113228 11:871070-871092 AACCTCTGCCTCCCAGATTCAGG + Intronic
1077145920 11:1044596-1044618 AACCTCTGCCTTTCCAGTTCTGG + Intergenic
1077277273 11:1718716-1718738 AACCTCTGCCTCCCGGATTCAGG - Intergenic
1077628260 11:3792527-3792549 AACCTCTGCATTCCGGGTTCAGG - Intronic
1077630089 11:3805766-3805788 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1077761152 11:5100178-5100200 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1078296269 11:10073633-10073655 AACCTCTGCCTCCCAGTTTCAGG - Intronic
1078942969 11:16029552-16029574 AACCTCCGCCTTCCAGGTTCAGG - Intronic
1079052636 11:17176083-17176105 AACCTCTGCCTCCCGGATTCAGG + Intronic
1079058844 11:17230014-17230036 AACCTCTGCCTCCCCGGTTCAGG + Intronic
1079204638 11:18404010-18404032 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1079217096 11:18523582-18523604 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1079513157 11:21234761-21234783 AACCTCTGGCCTTCTGCTTCTGG - Intronic
1079741645 11:24069854-24069876 AAGCTCTGCCTTCCGGGTTCAGG + Intergenic
1080001222 11:27352299-27352321 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1080278397 11:30528335-30528357 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1080618403 11:33966102-33966124 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1080728704 11:34924321-34924343 AACCTCTGCCTCCCGGTTTCAGG + Intronic
1080814179 11:35737752-35737774 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1081453139 11:43192864-43192886 GACCTCTGCCCCCCTGGTTCAGG + Intergenic
1081462061 11:43281001-43281023 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1081727674 11:45342550-45342572 ACCCTCTGACCTCCCTCATCTGG - Intergenic
1081911630 11:46703847-46703869 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1082054528 11:47802347-47802369 AACCTCCGCCCACCAGGTTCAGG - Intronic
1082061732 11:47866876-47866898 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1082076526 11:47980214-47980236 AACCTCTGCCCACCCGAACCCGG + Intergenic
1082084568 11:48039066-48039088 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1082094590 11:48118936-48118958 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1082240498 11:49864475-49864497 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1082701408 11:56436232-56436254 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1083043350 11:59709380-59709402 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1083445087 11:62703066-62703088 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1083480325 11:62940366-62940388 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1083503544 11:63133721-63133743 AACCTCTGCCTTCTGGGTTCAGG + Intronic
1083557291 11:63640684-63640706 AACCTCTGCCTCCCAGATTCAGG + Intronic
1083805508 11:65071426-65071448 AACCTCTGCCTTCCATGTTCAGG + Intronic
1083818865 11:65154692-65154714 AACCTCTGCCTCCCCAGTTCAGG + Intergenic
1083871917 11:65493672-65493694 AACCTCTGCCTTCCGGGTTCAGG - Intergenic
1084017045 11:66390354-66390376 AACCTCTGTCCCCCGGGTTCAGG + Intergenic
1084048408 11:66584469-66584491 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1084090075 11:66873847-66873869 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1084118126 11:67053729-67053751 AACCTCCGCCTTCCGGGTTCAGG - Intergenic
1084130645 11:67131491-67131513 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1084177385 11:67430185-67430207 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1084283379 11:68114613-68114635 AACCTCCGCCTTCCGGGTTCAGG - Intronic
1084339636 11:68487486-68487508 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1085173910 11:74470463-74470485 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1085285169 11:75354972-75354994 AAACTCTGCCTTCCAGGTTCAGG + Intergenic
1085429767 11:76437891-76437913 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1085502525 11:77037172-77037194 GACCTCTCCCCTCCCGCAGCTGG - Intronic
1085563508 11:77492251-77492273 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1085681238 11:78577028-78577050 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1085807545 11:79650061-79650083 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1085921799 11:80966331-80966353 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1086035506 11:82409710-82409732 AACCTCTGCCTCCCGGATTCAGG - Intergenic
1086198129 11:84166418-84166440 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1086884424 11:92188502-92188524 AACCTCTGCCCTCTGCCTCCAGG + Intergenic
1087005727 11:93468966-93468988 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1087011473 11:93518103-93518125 AACCTCTTCCCTCCAGCCCCTGG + Intronic
1087031826 11:93714330-93714352 AACTTCTGCCTTCCAGGTTCAGG + Intronic
1087424796 11:97972233-97972255 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1087771330 11:102213402-102213424 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1088277194 11:108100460-108100482 AACCTCTGCCCGCCAGGTTCAGG - Intronic
1088818801 11:113439755-113439777 AACCTCTACCTTCCGGGTTCAGG - Intronic
1088848421 11:113686639-113686661 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1088862506 11:113814968-113814990 AACCTCCGCCTTCCGGGTTCAGG - Intronic
1088865558 11:113844360-113844382 AACCTCTGCCTCCCGGCTCCCGG - Intronic
1088904811 11:114146765-114146787 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1089151780 11:116369958-116369980 CTCCTCTGCCCTCCTGCTTAGGG + Intergenic
1089331787 11:117694322-117694344 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1089514405 11:119023044-119023066 AACCTCTGCCTTCCGGGTTCAGG + Intronic
1089708877 11:120300680-120300702 AACCTCTGCCTCCCAGGTTCCGG - Intronic
1089846180 11:121460475-121460497 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1089960082 11:122609017-122609039 AAACTCCGCCTTCCCGGTTCAGG - Intergenic
1090005468 11:122998537-122998559 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1090061515 11:123467943-123467965 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1090079129 11:123599552-123599574 AACCTCTGCCTTCTGGGTTCAGG + Intronic
1090201291 11:124859122-124859144 AACCTCTGCCTCCCAGATTCAGG - Intergenic
1090354304 11:126129512-126129534 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1091420882 12:339094-339116 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1091431522 12:439436-439458 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1091723740 12:2831500-2831522 AACCTCTGCCTTCTAGGTTCAGG - Intronic
1091854653 12:3729619-3729641 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1091876459 12:3937880-3937902 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1091884940 12:4009828-4009850 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1091947937 12:4565705-4565727 AACCTCTGCCTTCCGGATTCAGG + Intronic
1092402856 12:8192071-8192093 AACCTCTGCCTCCCAGATTCAGG + Intergenic
1092482487 12:8872700-8872722 AACCTCTGCCTGCCAGGTTCAGG - Intronic
1092818608 12:12332600-12332622 AACCTCTGCCTTCCAGATTCAGG + Intronic
1092887275 12:12936063-12936085 AACCTCTGCCTTCTGGGTTCAGG + Intergenic
1093467438 12:19464666-19464688 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1093935336 12:24994570-24994592 AACCTCTGCCTCCCTGGTTCAGG - Intronic
1094020210 12:25906040-25906062 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1094028478 12:25984422-25984444 AACCTCTTCCTCCCCGGTTCAGG + Intronic
1094064762 12:26350774-26350796 AGCCTCTGCCCTCCTGCTCATGG - Intronic
1094601688 12:31914394-31914416 AACCTCTGCCTCCCCAGTTCCGG - Intergenic
1094639217 12:32257129-32257151 AACCTCCGCCTCCCCGGTTCAGG - Intronic
1094688988 12:32750281-32750303 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1095749139 12:45691926-45691948 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1095963344 12:47849930-47849952 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1096147233 12:49287108-49287130 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1096276459 12:50212894-50212916 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1096309585 12:50508785-50508807 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1096518047 12:52168842-52168864 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1096608244 12:52783005-52783027 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1096641781 12:53000550-53000572 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1096644620 12:53024734-53024756 AACCTCTGCCTGCCAGGTTCAGG + Intronic
1096700767 12:53381031-53381053 AACCTCTGCCTCCCGGATTCAGG + Intronic
1097130516 12:56807785-56807807 AACCTCTGCCTCCCAGATTCAGG - Intergenic
1097173759 12:57131066-57131088 AACCCCTGCCCTCTTGCCTCAGG + Intronic
1097215947 12:57413069-57413091 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1097317678 12:58189558-58189580 AACCTCTGCCTCCCAGTTTCAGG + Intergenic
1097496890 12:60350867-60350889 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1097501811 12:60412546-60412568 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1097781941 12:63716830-63716852 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1098094906 12:66944872-66944894 AACCTCTGCCACCCAGGTTCAGG + Intergenic
1098108327 12:67094524-67094546 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1098259167 12:68650029-68650051 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1098279946 12:68852636-68852658 AACCTCTGCCTTCTGGGTTCAGG + Exonic
1098405937 12:70126079-70126101 AACCTCTGCCTTCTGGGTTCCGG - Intergenic
1098854689 12:75638802-75638824 AACCTCTGCCCCCCTGGTTCAGG + Intergenic
1098900269 12:76105130-76105152 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1098969588 12:76837215-76837237 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1098997931 12:77143138-77143160 AACCTCTGCCTCCCGGGTTCGGG - Intergenic
1099303522 12:80927241-80927263 AAGCTCCGCCTTCCGGCTTCAGG + Intronic
1099367355 12:81784098-81784120 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1099466344 12:82993064-82993086 AACCTCTGCCTCCCGGATTCAGG + Intronic
1099598513 12:84700890-84700912 AATCTCTGCCTTCCAGATTCAGG + Intergenic
1099803994 12:87494378-87494400 AACCTCTGCCTTCCAAATTCAGG + Intergenic
1099867081 12:88296229-88296251 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1100245279 12:92751445-92751467 AACCTCTGCCTACCGGGTTCAGG + Intronic
1100257735 12:92901647-92901669 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1100327489 12:93553127-93553149 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1100382921 12:94078372-94078394 AATCTCTCACCTCCCGTTTCAGG - Intergenic
1100647523 12:96546745-96546767 AACCTCTGCCTCCCAGCTTCAGG - Intronic
1101073538 12:101102000-101102022 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1101145711 12:101838640-101838662 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1101158744 12:101952561-101952583 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1101666864 12:106824823-106824845 AACCTCCGCCTTCCAGGTTCAGG - Intronic
1101869875 12:108557293-108557315 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1101941557 12:109103031-109103053 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1102050965 12:109861664-109861686 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1102217101 12:111169354-111169376 AATGTCTTCTCTCCCGCTTCTGG - Intronic
1102229017 12:111249536-111249558 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1102504627 12:113375933-113375955 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1102670617 12:114615764-114615786 AAGCTCTGCCTTCCGGGTTCAGG - Intergenic
1102683413 12:114705597-114705619 AACCTCTGCCCCCTGGGTTCAGG + Intergenic
1102812851 12:115839463-115839485 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1102918660 12:116775176-116775198 AACCTCTACCTCCCCGGTTCAGG - Intronic
1103016139 12:117495970-117495992 AACCTCTGCCTTCCAGGTTCAGG - Intronic
1103084839 12:118054593-118054615 AACCTCTGCCTTCCGCCTCCCGG - Intronic
1103129625 12:118456383-118456405 AACCTCTGCCATCCAGACTCAGG + Intergenic
1103150185 12:118630977-118630999 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1103354092 12:120306719-120306741 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1103452686 12:121040460-121040482 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1103473617 12:121201632-121201654 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1103503652 12:121425224-121425246 AACCTCCGCCTTCCAGTTTCAGG - Intronic
1103540038 12:121659614-121659636 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1103580417 12:121910676-121910698 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1103643356 12:122370874-122370896 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1103652065 12:122440768-122440790 AACCTCCGCCTCCCCGGTTCAGG + Intergenic
1103660676 12:122513111-122513133 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1103777046 12:123373922-123373944 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1103833659 12:123800933-123800955 AACCTCTGCCTGCCAGGTTCAGG - Intronic
1104221866 12:126792874-126792896 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1104246402 12:127046120-127046142 AACCTCCGCCTCCCCGATTCAGG - Intergenic
1104520051 12:129465762-129465784 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1104623376 12:130334843-130334865 ACACTCTGCCCTCCCGCTGATGG - Intergenic
1104749679 12:131230257-131230279 CACCTCTCCCCTCCCGGCTCAGG - Intergenic
1104783747 12:131437041-131437063 CACCTCTCCCCTCCCGGCTCAGG + Intergenic
1104900695 12:132188251-132188273 GACCTCAGCCCTGCCGCTGCAGG + Intergenic
1105350450 13:19610393-19610415 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1105377194 13:19856556-19856578 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1105390566 13:19973587-19973609 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1105466322 13:20644417-20644439 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1105540830 13:21314956-21314978 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1106005801 13:25769320-25769342 AACCTCTGCCACCCCTCTTGAGG + Intronic
1106026435 13:25960092-25960114 AACCACAGCCCTCCTGCCTCTGG - Intronic
1106042686 13:26108811-26108833 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1106221642 13:27750627-27750649 AACCTCTGCCCCCCGGGTCCTGG - Intergenic
1106464741 13:30003180-30003202 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1106664196 13:31834560-31834582 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1106710687 13:32328321-32328343 AACCTCTGCCTTCTGGGTTCAGG + Intronic
1106816510 13:33413989-33414011 AACCACTGCACTCCAGCCTCAGG + Intergenic
1106954571 13:34922080-34922102 AACCTCTGCCTTCTGGGTTCAGG + Intergenic
1106962332 13:35013550-35013572 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1107033641 13:35878865-35878887 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1107466905 13:40659231-40659253 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1107869472 13:44733915-44733937 AACCTCCGCCTTCCGGGTTCAGG - Intergenic
1107891266 13:44916692-44916714 AACCTCTGCCTCCCGGATTCCGG - Intergenic
1107918276 13:45175702-45175724 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1108037748 13:46309240-46309262 AACCTCTGCCTTCTGGGTTCAGG - Intergenic
1108045713 13:46382612-46382634 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1108186407 13:47892580-47892602 CACCACTGCCCTCCTGCCTCTGG + Intergenic
1108186478 13:47892984-47893006 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1108280395 13:48855283-48855305 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1108291758 13:48968764-48968786 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1109071376 13:57773060-57773082 GACCTCTGCCCCCCAGGTTCAGG - Intergenic
1110224485 13:73105495-73105517 AACCTCTGCCTTGCGGGTTCAGG + Intergenic
1110285601 13:73746894-73746916 AACCTCTGCCTCCCTGGTTCAGG + Intronic
1110842488 13:80158373-80158395 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1111613752 13:90639001-90639023 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1111634710 13:90889052-90889074 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1112219105 13:97469988-97470010 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1112228900 13:97568244-97568266 AACCTCTTCACTCCAGCTCCAGG - Intergenic
1112265222 13:97917645-97917667 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1112474075 13:99715133-99715155 ATCCTGTGCTCTCCAGCTTCGGG + Intronic
1113302326 13:109035600-109035622 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1113396613 13:109954085-109954107 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1113840537 13:113357361-113357383 AACCTCTGCCTGCCAGGTTCAGG - Intronic
1113982430 13:114287886-114287908 AACCTCTGCCTTCCCAGTTCAGG + Intronic
1115143819 14:30203421-30203443 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1115226466 14:31108171-31108193 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1115274293 14:31590220-31590242 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1115401903 14:32971164-32971186 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1115983861 14:39083642-39083664 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1116077371 14:40127840-40127862 AACCTATGCCCTCTTGTTTCTGG - Intergenic
1116201543 14:41803943-41803965 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1116308682 14:43292588-43292610 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1116463700 14:45208412-45208434 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1116638067 14:47423891-47423913 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1116815594 14:49580801-49580823 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1116836427 14:49772872-49772894 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1116837228 14:49781285-49781307 AACCTCTGCCTTCCTGGTTCAGG - Intronic
1116857478 14:49965650-49965672 AACCTCTGCCACCCAGGTTCAGG - Intergenic
1117111926 14:52466309-52466331 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1117155163 14:52931945-52931967 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1117418884 14:55524035-55524057 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1117552305 14:56848448-56848470 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1118183009 14:63511995-63512017 AACCTCTGCCTTCCAGGTTCAGG - Intronic
1118407548 14:65441669-65441691 AACCTCTGCCTCCCGGATTCAGG - Intronic
1119048952 14:71347031-71347053 AGCCTCTGCCTTCCAGGTTCAGG + Intronic
1119095060 14:71822467-71822489 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1119230195 14:72973405-72973427 AACCTCCGCCTTCCAGGTTCAGG - Intronic
1119335045 14:73826480-73826502 AACCTCTGCCCTCCCCACCCCGG + Intergenic
1119526662 14:75328078-75328100 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1119624634 14:76161952-76161974 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1119892102 14:78190753-78190775 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1119927399 14:78508366-78508388 AACCTCTGCCTTCACCCTTGTGG - Intronic
1119943572 14:78667863-78667885 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1120233593 14:81866005-81866027 AGCCTCTGCCCCCCAGGTTCAGG + Intergenic
1120435593 14:84477701-84477723 AACCTCTGCCTTCCAGGTTCAGG - Intergenic
1120633482 14:86921519-86921541 AACCTCTGCCTTCTGGGTTCAGG + Exonic
1120974933 14:90240170-90240192 AACCTCTGCCTTCTGGGTTCAGG + Intergenic
1121126667 14:91411879-91411901 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1121264841 14:92594348-92594370 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1121291581 14:92780102-92780124 AACCTCGGCCCTCTGGATTCAGG + Intergenic
1121584502 14:95053879-95053901 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1121764772 14:96476421-96476443 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1121911951 14:97799748-97799770 TACCCCTGCCCTCCAGCCTCTGG - Intergenic
1122519194 14:102331328-102331350 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1122566023 14:102656855-102656877 AACCTCCGCCTTCCAGGTTCAGG + Intronic
1122566151 14:102658054-102658076 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1122602747 14:102929633-102929655 GACCCCTGCCCTCCCGCCGCAGG + Exonic
1122618724 14:103040538-103040560 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1122655094 14:103253183-103253205 AACCTCCGCCCCCCAGGTTCAGG - Intergenic
1122759763 14:104014359-104014381 AACCGCTGCCCTCCAGTCTCAGG + Intronic
1122792764 14:104191309-104191331 AGCCTCTGCTCTCCCCATTCAGG - Intergenic
1123626453 15:22230095-22230117 AGCCTCTGCCCTCCCTCAGCAGG + Intergenic
1123914246 15:25006137-25006159 AACCTCTGCCTCCCAGATTCAGG + Intergenic
1124116296 15:26846234-26846256 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1124190083 15:27567106-27567128 AACCTCCGCCTCCCCGGTTCGGG + Intergenic
1124246787 15:28077995-28078017 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1124579921 15:30944482-30944504 AACCTCTGCCTTCCAGGTTCAGG - Intronic
1124595817 15:31090553-31090575 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1125571011 15:40718139-40718161 AACCTCTGCCTTCCGGGCTCTGG - Intronic
1125583613 15:40804918-40804940 AACCTCTGCCCCCCAGGTTCAGG - Intronic
1125585540 15:40816636-40816658 AACCTCTGCCTCCCAGGTTCTGG - Intronic
1125588900 15:40842687-40842709 AACCTCTGCCTTCCAGATTCAGG - Intergenic
1125633919 15:41171310-41171332 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1125701513 15:41689645-41689667 AACCTCTGCCTACCAGGTTCAGG + Intronic
1125706171 15:41738311-41738333 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1125966758 15:43881053-43881075 AGCCTCAGCCCTCCCTCTTTTGG + Intronic
1126201439 15:45991562-45991584 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1126602981 15:50447642-50447664 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1126647426 15:50888931-50888953 AACTTCTGCCTCCCCGGTTCAGG - Intergenic
1126821972 15:52513347-52513369 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1127168408 15:56272060-56272082 AAGCTCTGCCTCCCCGGTTCCGG - Intronic
1127199865 15:56633570-56633592 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1127423448 15:58832306-58832328 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1127428677 15:58881110-58881132 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1127433584 15:58935104-58935126 AACCCCTGCCTTCCGGGTTCAGG - Intronic
1127497316 15:59525129-59525151 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1127552644 15:60056272-60056294 AACCTCCACCCGCCCGGTTCAGG + Intronic
1127603497 15:60562515-60562537 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1127672863 15:61212479-61212501 AACCTCTGCCTCCCAGGTTCGGG + Intronic
1127730495 15:61797515-61797537 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1127732517 15:61813809-61813831 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1127776060 15:62265099-62265121 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1127897702 15:63316966-63316988 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1128020782 15:64388386-64388408 AACCTCCGCCTTCCGGGTTCAGG + Intronic
1128024871 15:64426916-64426938 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1128030650 15:64477220-64477242 AAGCTCTGCCTCCCCGGTTCAGG + Intronic
1128045947 15:64617696-64617718 AACCTCTGCCTTCCAGATTCAGG - Intronic
1128175342 15:65550303-65550325 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1128275453 15:66349796-66349818 AACCTCTGCCCCCCAGGCTCAGG - Intronic
1128313036 15:66643656-66643678 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1128400334 15:67273150-67273172 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1128426589 15:67547535-67547557 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1128492663 15:68165201-68165223 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1128785276 15:70391741-70391763 AACCTCTGCCTCCCTGGTTCAGG - Intergenic
1128917694 15:71579455-71579477 CACCTATGCTCTCCCTCTTCTGG - Intronic
1129016143 15:72470730-72470752 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1129225383 15:74167470-74167492 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1129292644 15:74580107-74580129 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1129413800 15:75363722-75363744 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1129565647 15:76619992-76620014 AACCTCTGCCTCCCAGGTTCGGG - Intronic
1129713634 15:77834291-77834313 AACCTCTGCCTTCCAGGTTCAGG - Intergenic
1129989408 15:79949235-79949257 AACCTTTGCCTTCCGGGTTCAGG + Intergenic
1130122870 15:81067173-81067195 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1130528495 15:84726998-84727020 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1130532079 15:84755045-84755067 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1130571003 15:85043777-85043799 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1130631035 15:85569532-85569554 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1131045190 15:89308862-89308884 AACCTCCGCCCTCCAGGTTCAGG - Intronic
1131072561 15:89475315-89475337 AACCTCTGCCCCCCCGCCCCAGG + Intronic
1131084297 15:89563077-89563099 AACCTCTGCCTTCCGGGCTCAGG - Intergenic
1131129247 15:89885274-89885296 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1131191736 15:90322377-90322399 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1131256733 15:90867897-90867919 AACCTCTGCCTTCTGGGTTCAGG - Intergenic
1131370615 15:91878165-91878187 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1131495718 15:92909035-92909057 AACCTCCGCCTCCCAGCTTCAGG - Intronic
1132132633 15:99297097-99297119 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1132240159 15:100251654-100251676 AACCTCTGCCTCCCGGGTTCTGG - Intronic
1132876733 16:2143077-2143099 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1133137712 16:3723512-3723534 AACCTCTGCCTTCCGGGTTCAGG - Intergenic
1133160683 16:3909627-3909649 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1133195111 16:4163853-4163875 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1133275908 16:4638381-4638403 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1133386000 16:5371027-5371049 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1133501061 16:6367350-6367372 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1133558761 16:6930489-6930511 AACCTCTGCCTTCTGGGTTCAGG + Intronic
1133625069 16:7563547-7563569 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1133629494 16:7606201-7606223 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1133706333 16:8358428-8358450 TTCCCCTGCCCTCCCGGTTCAGG + Intergenic
1133743487 16:8669588-8669610 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1133804203 16:9110954-9110976 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1133966336 16:10534682-10534704 AACCTCCGCCTTCCGGGTTCAGG - Intronic
1134059390 16:11189955-11189977 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1134106672 16:11490312-11490334 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1134127461 16:11626258-11626280 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1134192386 16:12132178-12132200 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1134208426 16:12256407-12256429 AACCTCTGCCTCCCTGGTTCAGG + Intronic
1134234475 16:12454799-12454821 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1134236186 16:12468254-12468276 AACCTCTGCCTCCCAGTTTCAGG + Intronic
1134360903 16:13530217-13530239 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1134890608 16:17838390-17838412 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1135085294 16:19470268-19470290 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1135138245 16:19900509-19900531 AACCTCCGCCTTCCGGGTTCAGG - Intergenic
1135393120 16:22110611-22110633 AACCTCTGTCCTCCCTCTCTGGG + Intronic
1135567720 16:23524726-23524748 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1135574752 16:23576940-23576962 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1135710578 16:24713334-24713356 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1135746490 16:25021199-25021221 AACCTCCGCCCCCCCGCCCCAGG - Intergenic
1136122041 16:28143716-28143738 AACCTCTGCCACCCGGGTTCAGG + Intronic
1136177862 16:28530697-28530719 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1136357254 16:29753197-29753219 AACCTCTGCCTTCCAGGTTCAGG + Intergenic
1136369613 16:29828040-29828062 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1136374131 16:29855101-29855123 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1136391246 16:29965816-29965838 AACCTCTGCCTCCCAGTTTCAGG + Intronic
1136522871 16:30808496-30808518 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1136530662 16:30866493-30866515 AACCTCTGCCACCCAGGTTCAGG - Intronic
1137275620 16:46931537-46931559 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1137323999 16:47414442-47414464 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1137433953 16:48440658-48440680 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1138409267 16:56825291-56825313 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1138469818 16:57225140-57225162 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1139409538 16:66748194-66748216 AACCTCTGCCTCCCAGCCTCGGG - Intronic
1139566763 16:67782531-67782553 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1139609004 16:68041142-68041164 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1139619972 16:68131357-68131379 AGCCTCTGCCTTCCGGGTTCAGG + Intronic
1139698663 16:68693626-68693648 AACCTCTCCTCTCCCGAGTCTGG - Intronic
1139725116 16:68891376-68891398 AACCTCCGCCTCCCCGGTTCAGG - Intronic
1139792213 16:69447559-69447581 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1139871493 16:70112113-70112135 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1139874910 16:70138121-70138143 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1139877122 16:70155108-70155130 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1139880829 16:70178336-70178358 AACCTCTGCCTCCCAGATTCAGG + Intronic
1139892735 16:70264396-70264418 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1140101934 16:71925396-71925418 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1140149880 16:72352171-72352193 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1140251747 16:73300583-73300605 AACCTCTGCTCCCCAGGTTCAGG + Intergenic
1140349591 16:74249203-74249225 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1140364441 16:74370376-74370398 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1140371678 16:74417181-74417203 AACCTCTGCCTCCCAGATTCAGG - Intronic
1140424060 16:74845611-74845633 AACCTCTGCCTTCTGGGTTCAGG - Intergenic
1140567959 16:76066521-76066543 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1140902695 16:79384361-79384383 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1141138445 16:81481958-81481980 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1141368269 16:83464153-83464175 AACCTCTACCGTCCTGGTTCAGG + Intronic
1141482670 16:84317209-84317231 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1141951314 16:87341572-87341594 AACTTCCGCCTTCCCGGTTCAGG - Intronic
1141977939 16:87530118-87530140 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1142048671 16:87943342-87943364 AACCTCTGCCTCCCGGGTTCCGG + Intergenic
1142219941 16:88849194-88849216 AACCTCTGCCTTCCGGGCTCAGG + Intronic
1142384445 16:89753970-89753992 AACCTCCGCCTTCCAGGTTCAGG - Intronic
1142728257 17:1832008-1832030 AACCTCTGCCTTCTGGGTTCAGG + Intronic
1142905626 17:3039551-3039573 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1142958898 17:3539991-3540013 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1143131280 17:4679106-4679128 ACCCTCTGCCTCCCAGCTTCAGG + Intronic
1143213563 17:5207587-5207609 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1143224469 17:5288783-5288805 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1143233440 17:5377606-5377628 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1143526371 17:7475257-7475279 AACCTCCGCCTTCCGGGTTCAGG - Intronic
1143695621 17:8614398-8614420 AGCCTCTGCCTTCCCGGTTCAGG + Intronic
1143816357 17:9518784-9518806 AACCTCTGCCTTCCGGGTTCAGG - Intronic
1143959951 17:10708345-10708367 AACCTCTGCCTTCTGGTTTCAGG - Intronic
1144007251 17:11112223-11112245 AAGCTCTGCCTTCCAGGTTCAGG + Intergenic
1144030029 17:11311198-11311220 AACCTCTGCCTTCCAGGTTCAGG - Intronic
1144067759 17:11639919-11639941 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1144181393 17:12755788-12755810 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1144347257 17:14360394-14360416 AACCTCTGCCTTCCGGGTTCAGG + Intergenic
1144542834 17:16161369-16161391 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1144556264 17:16285501-16285523 AACCTCTGCCGCCCGGGTTCAGG - Intronic
1144631710 17:16876491-16876513 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1144691611 17:17269512-17269534 AACCTCCACCTTCCAGCTTCAGG - Intronic
1144818246 17:18051990-18052012 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1144904713 17:18631911-18631933 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1145185886 17:20793919-20793941 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1145223887 17:21111507-21111529 AACCTCTGCCTCCCAGTTTCGGG - Intergenic
1145372384 17:22317701-22317723 AACCTCTGCCTCCCGGATTCAGG - Intergenic
1145740530 17:27270439-27270461 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1145743071 17:27292685-27292707 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1146017454 17:29245344-29245366 AACCTCTGCCCCCCAGGTTCAGG - Intergenic
1146048619 17:29531679-29531701 AACCTCTGCCCCCGGGGTTCAGG - Intronic
1146125316 17:30226798-30226820 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1146129216 17:30256408-30256430 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1146189508 17:30752538-30752560 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1146221672 17:31028787-31028809 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1146240072 17:31212626-31212648 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1146331432 17:31930987-31931009 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1146334397 17:31956855-31956877 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1146646518 17:34580404-34580426 AACATCTGGCCGCCCGCCTCGGG + Intergenic
1146857552 17:36266323-36266345 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1146897022 17:36550017-36550039 AACCTCCGCCTTCCAGGTTCAGG + Intronic
1147002101 17:37370900-37370922 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1147076345 17:37990859-37990881 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1147077458 17:38002200-38002222 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1147087870 17:38070404-38070426 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1147109340 17:38250109-38250131 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1147267057 17:39240940-39240962 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1147362108 17:39937352-39937374 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1147736412 17:42641575-42641597 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1147848271 17:43420707-43420729 AACCTCTGCCCTCTGGGTTCAGG - Intergenic
1148059079 17:44822559-44822581 AACCTCTGCCTCCCGGTTTCAGG - Intronic
1148154328 17:45414022-45414044 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1148728127 17:49811186-49811208 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1149039894 17:52175774-52175796 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1149264273 17:54910372-54910394 AACCTCTGCCTCTCCGGTTCAGG - Intronic
1149599468 17:57884277-57884299 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1149680279 17:58501975-58501997 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1150055182 17:62007935-62007957 AAGCTCTGCCTTCCGGGTTCAGG - Intronic
1150111380 17:62503497-62503519 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1150218988 17:63485184-63485206 AACCTCTGCCTCCCCTCTCCAGG - Intronic
1150310769 17:64128074-64128096 AACCTCTGCCTCCCAGGTTCGGG + Intronic
1150319979 17:64205233-64205255 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1150553510 17:66232542-66232564 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1150584408 17:66504508-66504530 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1150603494 17:66671127-66671149 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1150671743 17:67206678-67206700 AACCTCTGCCGCCCAGGTTCAGG + Intronic
1150677102 17:67254114-67254136 AACCTCTGCCTTCCAGGTTCAGG + Intergenic
1150700880 17:67446026-67446048 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1150776015 17:68082323-68082345 AACCTCTGCCTTTCAGGTTCAGG + Intergenic
1150791500 17:68203689-68203711 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1150917123 17:69448462-69448484 AACCACAGACCTCCAGCTTCGGG - Intronic
1150923510 17:69508131-69508153 AACCTCTGCCCCCTGGTTTCAGG + Intronic
1150936576 17:69642575-69642597 AACCTCTGCCCCCCGGGTTCAGG + Intergenic
1151073294 17:71242234-71242256 TACCTCTTCCATCCTGCTTCAGG + Intergenic
1151279264 17:73060126-73060148 AACTTCTGCCTCCCGGCTTCAGG - Intronic
1151333133 17:73422937-73422959 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1151653548 17:75484954-75484976 AACCTCTGCCTCCCGGGTTCTGG - Intronic
1151665350 17:75542493-75542515 AGCCTCTGTGCTCCAGCTTCTGG - Intronic
1151778911 17:76228840-76228862 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1151793220 17:76323258-76323280 AACCTCTGCTTTCCAGGTTCAGG - Intronic
1151956977 17:77385242-77385264 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1152105730 17:78327665-78327687 AACCTCTGCCTCCCAGATTCAGG - Intergenic
1152107814 17:78341356-78341378 AACCTCTACCTCCCCGGTTCAGG - Intergenic
1152165297 17:78700604-78700626 AACCTCTGCCTGCCGGGTTCAGG + Intronic
1152173634 17:78771179-78771201 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1152193750 17:78904001-78904023 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1152198734 17:78933092-78933114 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1152221263 17:79068710-79068732 AACCTCTGCCTTCCAGGTTCAGG + Intergenic
1152468858 17:80479790-80479812 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1152643254 17:81457838-81457860 AACCCCTGCCCTCCCCCTCCTGG - Intronic
1152643323 17:81458018-81458040 AACCTCTGCCCTCCCCCTCCTGG - Intronic
1152651243 17:81494208-81494230 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1152815151 17:82403548-82403570 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1152824770 17:82458117-82458139 AGCATCTGCCCTCGGGCTTCCGG + Intergenic
1152866732 17:82728504-82728526 AACCTCTGCCCTCCGCCTTCTGG + Intronic
1152884406 17:82840886-82840908 AGCCTCTGCCCTGCAGCCTCAGG - Intronic
1153112072 18:1603563-1603585 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1153293345 18:3522622-3522644 AACCTCCGCCTTCCGGGTTCAGG + Intronic
1153372706 18:4337273-4337295 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1153563871 18:6399353-6399375 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1153834887 18:8955072-8955094 AAGCTCTGCCTCCCCGGTTCAGG + Intergenic
1153853229 18:9117116-9117138 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1154005947 18:10527104-10527126 AAGCTCTGCCTTCCGGGTTCAGG - Intronic
1154132440 18:11749042-11749064 AACCTCTGCCTCCCAGCTTCAGG - Intronic
1154146196 18:11868041-11868063 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1154178788 18:12111165-12111187 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1154180218 18:12130772-12130794 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1154231665 18:12561349-12561371 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1155193900 18:23455151-23455173 GACCTCTGCCTTCCGGGTTCAGG + Intronic
1155301665 18:24434679-24434701 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1155364781 18:25039134-25039156 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1155382242 18:25236452-25236474 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1155875556 18:31082637-31082659 AACCTCTGCCTTCCACGTTCAGG + Intronic
1155913181 18:31528626-31528648 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1156150246 18:34233509-34233531 AAGCTCTGCCTTCCGGGTTCAGG - Intergenic
1156180929 18:34602919-34602941 AACCTCTGCCTCACCGGTTCAGG - Intronic
1156898316 18:42271922-42271944 AACCTTTGCCCCCCTGCTTAAGG - Intergenic
1157123766 18:44936213-44936235 AGCCTCTGCCCTCCCTGCTCAGG - Intronic
1157319963 18:46626454-46626476 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1157537301 18:48469276-48469298 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1157830445 18:50852426-50852448 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1157840040 18:50948919-50948941 AACCTCTGCCTCCTCGGTTCAGG + Exonic
1158224759 18:55189572-55189594 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1158342618 18:56482892-56482914 AACCTCTGCCTCCCCAGTTCAGG - Intergenic
1158437232 18:57442078-57442100 AAGCTCTTCCTTCCCGCTTGTGG + Intronic
1158464749 18:57680193-57680215 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1158626996 18:59080206-59080228 AACCTCTGCCTTCCGGGTTCAGG + Intergenic
1158709817 18:59827524-59827546 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1158734877 18:60068452-60068474 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1158940422 18:62402297-62402319 ACCCTCTGCACTCTCGCTTCTGG + Intergenic
1159489081 18:69106294-69106316 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1159593338 18:70358423-70358445 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1159787505 18:72731356-72731378 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1159954468 18:74509549-74509571 AACCTCTGCCTCCCTGGTTCAGG - Intronic
1160168970 18:76537409-76537431 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1160286227 18:77546356-77546378 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1160459699 18:79029133-79029155 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1160821430 19:1060599-1060621 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1160890016 19:1372673-1372695 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1161107377 19:2451165-2451187 AACCTCTGCCTCCCGGATTCAGG - Intronic
1161123961 19:2545567-2545589 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1161319220 19:3633322-3633344 CACCTGTGCCCTCCCGCCCCGGG + Intronic
1161429513 19:4223480-4223502 AACCTCTGCCTCCCGGCTCCCGG + Intronic
1161429879 19:4225326-4225348 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1161431418 19:4234479-4234501 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1161435507 19:4260344-4260366 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1161612176 19:5249227-5249249 AACCTCTGCCTCCCGGGTTCCGG - Intronic
1161660398 19:5542240-5542262 AACCTCTGCCTCCCAGATTCAGG - Intergenic
1161690351 19:5729175-5729197 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1161779461 19:6281213-6281235 AACCTCTGCCTCCCTGGTTCAGG - Intergenic
1161806476 19:6446279-6446301 AACCTCCGCCTCCCCGGTTCAGG - Intronic
1161819881 19:6523535-6523557 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1161868018 19:6848873-6848895 AACCTCTGCCTCCCAGATTCAGG + Intronic
1161879073 19:6934677-6934699 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1161966011 19:7549568-7549590 AACCTCAGCCTTCCAGGTTCAGG + Intronic
1162111589 19:8402742-8402764 AACCTCCGCCTTCCAGGTTCAGG + Intronic
1162126623 19:8502834-8502856 AACCTCTGCCTCCCGGGTTCAGG + Exonic
1162140363 19:8581751-8581773 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1162147712 19:8623069-8623091 CACCTCTGCACTCCAGCCTCTGG - Intergenic
1162339519 19:10083764-10083786 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1162414603 19:10527659-10527681 AACCTCTGCCTCCTGGCTTCAGG + Intergenic
1162423965 19:10582905-10582927 AACCTCTGCCTTCCAGGTTCAGG + Intronic
1162445548 19:10720292-10720314 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1162501255 19:11055269-11055291 AACCTCTGCCACCCAGGTTCAGG + Intronic
1162556771 19:11391857-11391879 AACCTCTGCCTGCCTGGTTCAGG + Intronic
1162571619 19:11477772-11477794 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1162654892 19:12121180-12121202 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1163248022 19:16109384-16109406 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1163277948 19:16297377-16297399 AACCTCTGCCTCCCCAGTTCAGG + Intergenic
1163307139 19:16487717-16487739 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1163343976 19:16727977-16727999 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1163435123 19:17290881-17290903 AACCTCCGCCCCCCGGGTTCAGG - Intergenic
1163456590 19:17409831-17409853 AACCTCTGACCTCCGCCTCCTGG + Intronic
1163568443 19:18065735-18065757 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1163600266 19:18244915-18244937 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1163738505 19:18996312-18996334 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1163785222 19:19271610-19271632 AACCTCTGCCTTCTGGGTTCAGG + Intronic
1163893282 19:20035815-20035837 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1163975620 19:20849104-20849126 AACCTCTGCCTCCCTGGTTCAGG + Intronic
1163985370 19:20942246-20942268 AACCTCTGCCTTTCAGGTTCAGG + Intronic
1163988537 19:20975566-20975588 AACCTCTGCAGCCCAGCTTCAGG - Intergenic
1164065830 19:21716252-21716274 AACCTCTGCCATCTGGGTTCAGG + Intergenic
1164215721 19:23144616-23144638 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1164462081 19:28457532-28457554 CCCCTCTGCCCTCTGGCTTCTGG - Intergenic
1164511664 19:28902440-28902462 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1164515943 19:28935258-28935280 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1164731355 19:30507267-30507289 AACCTCTGCCATCCGGGTTCAGG - Intronic
1164963730 19:32460945-32460967 AACCTCTGCCTTCCGGGTTCAGG + Intronic
1165010386 19:32841823-32841845 AGCCTCTGCCTCCCCGGTTCAGG - Intronic
1165032797 19:33010462-33010484 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1165057161 19:33185008-33185030 AACCTCTGCCTTGCAGATTCAGG + Intronic
1165163288 19:33831443-33831465 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1165322229 19:35092918-35092940 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1165410332 19:35656560-35656582 AACCTCCGCCTTCCAGGTTCAGG + Intronic
1165445418 19:35854401-35854423 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1165546885 19:36545442-36545464 AACCTCTGCCTCCCAGGTTCAGG - Exonic
1165619860 19:37236649-37236671 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1165754865 19:38287103-38287125 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1165778035 19:38416379-38416401 AACCTCTGCCTCCCGGATTCAGG - Intronic
1165807704 19:38591447-38591469 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1165864341 19:38927016-38927038 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1165886155 19:39080130-39080152 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1165919194 19:39282772-39282794 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1166087404 19:40486207-40486229 AACCTCTGCCTCCCAGCCTCAGG - Intronic
1166229227 19:41416023-41416045 AACTTCTGCCTTCCAGGTTCAGG + Intronic
1166988973 19:46679246-46679268 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1167059945 19:47138123-47138145 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1167108617 19:47446120-47446142 AGCCTCTGCGCTTCCGCCTCGGG - Intronic
1167195026 19:48022606-48022628 CCCCTCTGCTCTCCTGCTTCTGG - Intronic
1167338684 19:48902190-48902212 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1167397103 19:49237489-49237511 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1167554128 19:50182322-50182344 AACCTCTGCCCCCCCACCCCGGG - Intergenic
1167670164 19:50847749-50847771 AACCTTTGCCTTCCCGGTTAAGG + Intergenic
1167851848 19:52208248-52208270 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1167919147 19:52768356-52768378 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1167947729 19:53002406-53002428 AACCTCTGCCTCCCAGATTCAGG - Intergenic
1167975968 19:53226186-53226208 AACCTCTGCCTTCCAGGTTCAGG - Intergenic
1168018189 19:53590222-53590244 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1168223228 19:54976128-54976150 AACCTCTGACCTCCGCCTCCCGG + Intronic
1168542827 19:57227373-57227395 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1168564178 19:57409193-57409215 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1168608992 19:57783990-57784012 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1168653195 19:58106840-58106862 AACCTCTGCCTCCCAGCTTCAGG + Intronic
925293381 2:2762858-2762880 GACCTCTGGCCTCACCCTTCCGG - Intergenic
925474532 2:4198162-4198184 AACCTCTGCCTTCCAGGCTCAGG - Intergenic
925480161 2:4261532-4261554 AACCTCTGCCTCCCCGGTTCAGG - Intergenic
926020054 2:9486745-9486767 AACCTCTGCCTCCCGGGTTCAGG - Intronic
926025050 2:9534451-9534473 AACCTCTGCCTCCCCGGTTCAGG - Intronic
926172687 2:10562754-10562776 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
926182883 2:10661451-10661473 AACCTCTGCCTCCCGGGTTCAGG + Intronic
926185979 2:10690852-10690874 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
926442704 2:12907043-12907065 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
926529685 2:14028733-14028755 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
927016624 2:18970023-18970045 AGTCTCTGCCCTCTCTCTTCTGG + Intergenic
927158144 2:20233832-20233854 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
927377239 2:22432255-22432277 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
927406879 2:22780864-22780886 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
927671121 2:25069776-25069798 AACCTCTGCCTCCCGGGTTCAGG + Intronic
927715042 2:25346316-25346338 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
927730855 2:25470455-25470477 AACCTCTGCCTCCCAGGTTCAGG + Intronic
927972999 2:27317303-27317325 ATCCACTCCCCTCCCGCTGCTGG - Intronic
927987751 2:27424921-27424943 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
928024996 2:27732138-27732160 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
928075438 2:28260381-28260403 AACCTCTGCCTCCCGGGTTCAGG + Intronic
928298437 2:30105399-30105421 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
928832064 2:35499373-35499395 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
928907379 2:36381703-36381725 AACCTCTGCCTCCCCGGTTCAGG - Intronic
928963897 2:36957830-36957852 AACCTCTGCCTCCCAGGTTCAGG + Intronic
928991724 2:37239198-37239220 AACCTCTGCCTCCCAGGTTCAGG + Intronic
929155574 2:38785882-38785904 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
929699532 2:44150193-44150215 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
930131701 2:47858598-47858620 AACCTCTGCCTCCCAGGTTCAGG - Intronic
930135146 2:47895772-47895794 AACCTCTGCCTTCTGGTTTCAGG + Intronic
930319393 2:49835369-49835391 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
930321108 2:49855943-49855965 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
930422296 2:51168522-51168544 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
930608795 2:53518731-53518753 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
930794212 2:55370557-55370579 AACCTCTGCCTCCCAGGTTCAGG - Intronic
930820159 2:55638218-55638240 AACCTCTGCCTCCCAGATTCAGG - Intronic
930862821 2:56092477-56092499 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
931228758 2:60356446-60356468 ATTCTCTGCCCTCCCGCATCTGG + Intergenic
931275031 2:60736994-60737016 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
931328477 2:61253814-61253836 AACCTCTGCCTCCCAGGTTCAGG + Intronic
931342316 2:61413576-61413598 AGCCTCTGCCTTCCAGGTTCAGG - Intronic
931446062 2:62328205-62328227 AACCTCTGCCCCCAGGGTTCAGG - Intergenic
931505361 2:62920742-62920764 AACCTCTGCCTTCTGGGTTCAGG + Intronic
931580181 2:63763418-63763440 AACCTCTGCCTTTCAGGTTCAGG - Intronic
932174967 2:69591650-69591672 AACCTCTGCCTCCCAGGTTCAGG + Intronic
932245710 2:70194308-70194330 AACCTCTGCCTCCCGGGTTCAGG - Intronic
932426242 2:71637293-71637315 AACCTCTGCCCTCATGCCTGGGG - Intronic
932743634 2:74312849-74312871 AACCTCTGCCTCCCAGGTTCAGG - Intronic
932764814 2:74462858-74462880 GACCTCTGTCCTCCCACTTCAGG + Exonic
932774868 2:74522243-74522265 ACCCACTGCACTCCAGCTTCAGG - Intronic
932946412 2:76237839-76237861 AACCTCTGCCTCCCGGCTTCAGG + Intergenic
933212897 2:79592200-79592222 AACCTCTGCCTCCCGGGTTCAGG + Intronic
933557196 2:83845498-83845520 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
933697926 2:85234215-85234237 AACCTCTGCCTCCCAGGTTCAGG + Intronic
933705447 2:85286107-85286129 AACCTCTGCCTCCCGGGTTCAGG - Intronic
933907225 2:86906922-86906944 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
933908471 2:86916584-86916606 AACCTCTGCCTCCCGGGTTCAGG + Intronic
934024253 2:87986796-87986818 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
934065465 2:88336653-88336675 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
934694421 2:96388896-96388918 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
935059108 2:99592852-99592874 AACCTCTGCCTCCCAGGTTCAGG - Intronic
935083857 2:99826094-99826116 AACCTCTGCCTCCCAGGTTCAGG + Intronic
935727255 2:106034405-106034427 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
935906370 2:107844915-107844937 AACCTCTGCCTCCCGGGTTCAGG + Intronic
935926235 2:108072754-108072776 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
935986588 2:108679396-108679418 AACCTCTGCCTCCCGGGTTCAGG - Intronic
936077081 2:109408418-109408440 CTCATCTGCCCTCCCGCTCCAGG + Intronic
936098012 2:109548692-109548714 AACCTCGGCCTCCCGGCTTCAGG - Intronic
936174857 2:110210814-110210836 AACCTCTGCCTCCTCGGTTCAGG - Intergenic
936364891 2:111844485-111844507 AACCTCTGCCTCCCGGGTTCAGG - Intronic
936592648 2:113818732-113818754 CGCCGCTGCCCTCCTGCTTCAGG + Intergenic
936658693 2:114518157-114518179 AACCTCTGCCTCCCAGGTTCAGG + Intronic
937056674 2:118943488-118943510 AGCCTCTGGCCTCTGGCTTCTGG + Intronic
937401404 2:121587157-121587179 AACCTCCGCCTTCCAGGTTCAGG - Intronic
937441866 2:121922422-121922444 AACCTCTGCCTCCCAGTTTCAGG + Intergenic
937948205 2:127361229-127361251 AACCTCTGCCTCCCGGGTTCAGG - Intronic
938392764 2:130917902-130917924 AACCTCTGCCTCCCGGATTCAGG + Intronic
938531014 2:132186057-132186079 AACCTCTGCCTCCCAGGTTCAGG - Intronic
938731122 2:134148838-134148860 AACCTCTGCCTCCCTGGTTCAGG + Intronic
938815210 2:134895777-134895799 AACCTCTGCCTCCCGGATTCAGG - Intronic
938835801 2:135102931-135102953 AACCTCTGCCTACCGGGTTCAGG - Intronic
939210907 2:139173999-139174021 AACCTCTGCCTCCCAGATTCAGG - Intergenic
939367038 2:141246881-141246903 AACCTCTGCCTCCCAGGTTCAGG - Intronic
940350803 2:152685054-152685076 AACCTCTGCCTCCCGGGTTCAGG - Intronic
940525446 2:154808160-154808182 AACCTCTGCCTCCCAGGTTCAGG + Intronic
940855168 2:158723792-158723814 AACCTCTGCCCTCCCATCACAGG + Intergenic
941028126 2:160480997-160481019 AACCTCTGCCTCCCAGGTTCAGG - Intronic
941384023 2:164831238-164831260 AACCTCTGCCTCCCAGGTTCAGG - Intronic
941668686 2:168267329-168267351 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
942029957 2:171949590-171949612 AACCTCTGCCTCCCAGGTTCAGG - Intronic
942180959 2:173380243-173380265 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
942653976 2:178195244-178195266 CACCCCTGCCCACCCGCTGCTGG + Intronic
942656417 2:178218709-178218731 AACCTCTGCCTCCCGGGTTCAGG + Intronic
942736209 2:179116190-179116212 AACCTCTGCCTCCCAGGTTCAGG - Intronic
942955223 2:181765262-181765284 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
943027863 2:182651086-182651108 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
943053424 2:182945151-182945173 AACCTCTGCCTCCCGGGTTCAGG - Intronic
943438645 2:187899040-187899062 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
943698350 2:190961277-190961299 AACCTCTGCCTCCCAGGTTCAGG + Intronic
944409899 2:199429826-199429848 AACCTCTGCCTGCCGGTTTCAGG - Intronic
944587951 2:201189348-201189370 AACCTCTGCCTCCCAGGTTCAGG + Intronic
944708547 2:202315012-202315034 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
944733454 2:202538038-202538060 AACCTCTGCCTCCCAGGTTCAGG - Intronic
944740172 2:202604262-202604284 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
944753235 2:202732737-202732759 AACCTCTGCCGCCCAGGTTCAGG - Intronic
944824850 2:203472212-203472234 AACCTCTGCCTCCCAGCTTCAGG + Intronic
944851600 2:203725206-203725228 AACCTCCGCCCTCTGGGTTCAGG - Intronic
944974946 2:205039549-205039571 AACCTCTGCCTCCCGGATTCAGG + Intronic
945519716 2:210810593-210810615 AACCTCTGCCTTCTGGGTTCAGG + Intergenic
945727405 2:213488991-213489013 AACCTCCGCCTTCCGGATTCAGG - Intronic
946000736 2:216479968-216479990 AACCTCTGCCTCCCAGGTTCAGG - Intronic
946082932 2:217140711-217140733 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
946153385 2:217791122-217791144 AAGCTCTGCCCTGCAGCCTCAGG + Intergenic
946238155 2:218338063-218338085 AACCTCTGCCTCCCAGGTTCAGG - Intronic
946357392 2:219196693-219196715 AACCTCTGCCCTCTGGGTTCAGG + Intronic
946455552 2:219822987-219823009 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
947105127 2:226661210-226661232 AACCTCCGCCTCCCCGGTTCAGG + Intergenic
947108196 2:226689927-226689949 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
947417206 2:229909006-229909028 AACCTCTGCCTCCCAGGTTCAGG - Intronic
947615535 2:231554721-231554743 GCCCTCTGCCCTCCCTCTGCAGG + Intergenic
947842149 2:233214693-233214715 AACCTCTGCCTCCCAGATTCAGG - Intronic
947967700 2:234295986-234296008 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
948152058 2:235752257-235752279 AACCTCTGCCTCCCAGGTTCAGG + Intronic
948300921 2:236906614-236906636 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
948441418 2:237993067-237993089 AACCTCTGCCTCCCAGGTTCAGG + Intronic
948957640 2:241306341-241306363 AACCTCTGCCTCCCAGGTTCAGG + Intronic
948967879 2:241398649-241398671 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1168769369 20:405073-405095 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1169059910 20:2653731-2653753 AACCTCTGCCTCCCTGGTTCAGG + Intronic
1169110438 20:3029616-3029638 AACCTCTGCCTCCCAGGTTCTGG + Intronic
1170103781 20:12730986-12731008 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1170154993 20:13261334-13261356 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1170211248 20:13848106-13848128 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1170593034 20:17785661-17785683 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1170612311 20:17924773-17924795 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1170683756 20:18550234-18550256 AACCTCCGCCTTCCAGGTTCAGG + Intronic
1170822155 20:19763304-19763326 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1170860785 20:20101705-20101727 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1170977233 20:21176226-21176248 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1170984744 20:21247065-21247087 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1171324333 20:24277567-24277589 ATCCTCTACCCTCCCACTACTGG + Intergenic
1171391429 20:24803910-24803932 AACCTCTGCCTCCCAGGTTCCGG + Intergenic
1171974999 20:31588698-31588720 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1171979419 20:31617103-31617125 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1172008903 20:31835099-31835121 AACCTCCGCCTCCCGGCTTCAGG + Intergenic
1172077498 20:32310582-32310604 AACCTCTCCCTTTCCGCTTTGGG + Exonic
1172082342 20:32351926-32351948 AACCTCTGCCACCCGGGTTCAGG - Intergenic
1172120266 20:32594229-32594251 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1172228173 20:33319170-33319192 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1172398245 20:34625284-34625306 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1172440118 20:34959557-34959579 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1172463941 20:35141036-35141058 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1172505392 20:35457715-35457737 AACCTCTGCCTCCCCGGTTCAGG - Intronic
1172574398 20:35996587-35996609 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1172763767 20:37339966-37339988 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1172765607 20:37349115-37349137 TACCTCTGGCCTCCAGCTTGGGG - Intronic
1172815559 20:37683151-37683173 AACCTCTGCCTCCCTGGTTCAGG - Intergenic
1172899316 20:38322690-38322712 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1172910393 20:38404886-38404908 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1172921302 20:38484775-38484797 AACCTCTGTCTTCCAGGTTCAGG + Intronic
1173285477 20:41667747-41667769 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1173475573 20:43356771-43356793 TCCCTCTGCCCTCCAGCTTCTGG + Intergenic
1173494837 20:43511125-43511147 AACCTCTACCCTCCACCTCCCGG + Intronic
1173517077 20:43672127-43672149 AACCTCTGCCCCCCAGGTTCAGG - Intronic
1173518966 20:43685063-43685085 AACCTCCGCCTCCCCACTTCAGG - Intronic
1173630535 20:44510993-44511015 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1173650333 20:44659709-44659731 ACCATCTGCCTTCCAGCTTCCGG + Intergenic
1174373065 20:50106751-50106773 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1174438257 20:50527423-50527445 AACCTCTGCCTCCCGGCTTCAGG + Intronic
1174453641 20:50634949-50634971 AACCTCTGCCTCCCGGATTCAGG - Intronic
1174455839 20:50648192-50648214 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1174461171 20:50683997-50684019 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1174586982 20:51617021-51617043 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1174947119 20:55000060-55000082 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1175082713 20:56434516-56434538 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1175574212 20:60048444-60048466 AACCTCTGCCTCCCTGGTTCAGG - Intergenic
1175601455 20:60277102-60277124 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1176003935 20:62849081-62849103 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1176009201 20:62883002-62883024 AACCTCTGCTTTCCAGGTTCAGG + Intronic
1176082207 20:63279285-63279307 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1176242405 20:64081138-64081160 GACCTCTGACCTCCCCCTTCGGG - Intronic
1176277575 20:64281297-64281319 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1176368941 21:6051059-6051081 AACCTCTGCCTTCCTGGTTCAGG + Intergenic
1176718804 21:10377153-10377175 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1176936682 21:14875860-14875882 GACCTCTGACCTCCCTCTTCAGG + Intergenic
1177073926 21:16548570-16548592 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1177398988 21:20577239-20577261 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1177547077 21:22572635-22572657 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1177567697 21:22845548-22845570 AACCTCTGCCTCCCCAGTTCAGG - Intergenic
1177576524 21:22963565-22963587 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1177815407 21:25971127-25971149 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1178185878 21:30219776-30219798 AACCTCTGCCTTCCAGGTTCAGG + Intergenic
1178260131 21:31091961-31091983 AAACTCTGCCTTCCAGGTTCAGG + Intergenic
1178449973 21:32689376-32689398 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1178525657 21:33326284-33326306 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1178877035 21:36421566-36421588 AACCTCCGCCCTCCGAGTTCAGG + Intergenic
1178969884 21:37164418-37164440 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1179676059 21:42982889-42982911 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1179754578 21:43487482-43487504 AACCTCTGCCTTCCTGGTTCAGG - Intergenic
1179886420 21:44316073-44316095 CATCTCTGCCCTCGCGCTCCAGG + Intronic
1179924102 21:44522887-44522909 AACATCTGCCCTCCCTGTGCTGG + Intronic
1180300027 22:11030047-11030069 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1180658544 22:17445672-17445694 AACCTCTGCCTCCCAGGTTCGGG + Intronic
1180661511 22:17471615-17471637 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1180857102 22:19055032-19055054 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1180884361 22:19230176-19230198 AATCTCTGCCCTCCACCTCCTGG + Intronic
1180994138 22:19956456-19956478 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1181006021 22:20013952-20013974 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1181152130 22:20892100-20892122 AACCTCTGCCTTCCGGGTTCAGG - Intergenic
1181258778 22:21582433-21582455 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1181267678 22:21640333-21640355 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1181479074 22:23186165-23186187 ACTCTCTGCCCTCCAACTTCTGG - Intronic
1181549181 22:23627152-23627174 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1181899768 22:26143798-26143820 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1182261066 22:29073304-29073326 AGCCCCCTCCCTCCCGCTTCAGG + Intronic
1182315584 22:29444739-29444761 AACGTCTGCCTTCCAGGTTCAGG - Intergenic
1182330258 22:29546509-29546531 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1182478999 22:30594436-30594458 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1182484968 22:30634079-30634101 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1182492830 22:30684853-30684875 AACCTCTGCCTGCCAGGTTCAGG - Intergenic
1182500010 22:30739919-30739941 AACCTCTGCCTCCCCGGTCCTGG + Intronic
1182542620 22:31052689-31052711 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1182598196 22:31438802-31438824 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1182632441 22:31697031-31697053 AACCTCTGCCTTCCAGGTACAGG - Intronic
1183088203 22:35500962-35500984 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1183132946 22:35856948-35856970 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1183278232 22:36915164-36915186 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1183327314 22:37201423-37201445 AACCTCTGCCTCCCAGATTCAGG + Intergenic
1183416062 22:37682562-37682584 AACCTCTGCCTTCCGGGCTCAGG - Intronic
1183449113 22:37881488-37881510 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1183553635 22:38507975-38507997 AACCTCTGCCGCCCGGGTTCAGG + Intergenic
1183916008 22:41119894-41119916 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1183925516 22:41203060-41203082 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1184135260 22:42545213-42545235 AACCTCTGCCTCCCGGGTTCTGG + Intergenic
1184223292 22:43114382-43114404 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1184230883 22:43157753-43157775 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1184415898 22:44351645-44351667 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1184558961 22:45250348-45250370 AACCTCTGCCTTCCAGGTTCAGG - Intergenic
1184614055 22:45625930-45625952 AACCTCTGCCTCCCGGGTTCGGG + Intergenic
1184618980 22:45659890-45659912 GACCTCTGCCTTCCAGGTTCAGG + Intergenic
1184802720 22:46771674-46771696 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1184994063 22:48191080-48191102 AACCTCTGCCTTCTGGGTTCAGG + Intergenic
949317896 3:2777060-2777082 AACCTCTGCCTCCCAGGTTCAGG + Intronic
949366041 3:3281660-3281682 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
949529005 3:4935210-4935232 AACCTCCGCCTCCCAGCTTCAGG - Intergenic
950224930 3:11225765-11225787 AACCTCTGCCTCCCGGGTTCAGG + Intronic
950278615 3:11685278-11685300 AACCTCTGCCTCCCAGGTTCAGG + Intronic
950589110 3:13922749-13922771 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
950693228 3:14677580-14677602 AACCTCTGCCTCCCGGGTTCAGG + Intronic
951108050 3:18768691-18768713 AACCTCTGCCTACCAGATTCAGG - Intergenic
951699647 3:25482619-25482641 AACCTCTGCCTCCCAGGTTCAGG + Intronic
951705975 3:25545041-25545063 AACCTCTGCCGTCCAGGTTCAGG + Intronic
951782839 3:26384423-26384445 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
951874999 3:27414196-27414218 AACCTCTGCCTCCCGGGTTCAGG - Intronic
951893583 3:27589022-27589044 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
952359540 3:32615790-32615812 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
952372741 3:32738984-32739006 AACCTCTGCCTACCAGTTTCAGG + Intronic
952412775 3:33064356-33064378 AACCTCTGCCTCCCAGGTTCAGG - Intronic
952458016 3:33492624-33492646 AACTTCTGGCCTCCAACTTCTGG - Intergenic
952776619 3:37052457-37052479 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
952815092 3:37440926-37440948 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
952824726 3:37515340-37515362 AACCTCTGCCCTCTCCCAACTGG - Intronic
952930166 3:38353803-38353825 AACCTCTGCCTCCCAGGTTCAGG - Intronic
953331282 3:42054999-42055021 AATCTCTGCCTTCCAGGTTCAGG + Intronic
953912197 3:46898865-46898887 CCCCTCTGCCCGCCCGCTCCCGG + Intronic
953953733 3:47214038-47214060 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
954006539 3:47595814-47595836 AACCTCTGCCTCCCTGGTTCAGG + Intronic
954238103 3:49272624-49272646 AACCTCTGCCCTCTGCCTCCTGG + Intronic
954559932 3:51548268-51548290 AACCTCTGCCTCCCAGGTTCAGG + Intronic
954620998 3:51995518-51995540 CACCTCTGCCCCCCCCATTCTGG + Intronic
954679450 3:52334709-52334731 AACCTCTGCCTCCCAGGTTCAGG - Intronic
954845558 3:53552460-53552482 AACCTCTGCCTTCCAGGTTCAGG + Intronic
954980262 3:54739336-54739358 AACCTCTGCCTCCCAGGTTCAGG - Intronic
955006718 3:54975435-54975457 AACCTCTGCCTCCCAGGTTCAGG - Intronic
955132655 3:56186611-56186633 AACCTCTGCCCTCTGCCTCCTGG + Intronic
955290944 3:57692144-57692166 AACCTCTGCCTCCCGGATTCAGG - Intronic
955305790 3:57830114-57830136 AACCTCTGCCTCCCGGGTTCAGG + Intronic
955847837 3:63185898-63185920 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
955894284 3:63682832-63682854 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
956210776 3:66799241-66799263 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
956227675 3:66977878-66977900 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
956416728 3:69039165-69039187 AACCTCTGCCTCCCAGCTTCAGG + Intronic
956418132 3:69054443-69054465 AACCTCTGCCTCCCCGGTTCAGG - Intergenic
956638133 3:71386659-71386681 AACCTCTGCCTCCCGGGTTCAGG - Intronic
956864466 3:73355843-73355865 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
957414485 3:79883355-79883377 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
957789167 3:84918255-84918277 AACCTCTGCCTTCCAGGTTCAGG - Intergenic
958515426 3:95109351-95109373 AACCTCTGCCTCCCAGATTCAGG + Intergenic
958571227 3:95885119-95885141 AAGCTCTGCCTCCCCGGTTCAGG + Intergenic
958808004 3:98835052-98835074 AACCTCTGCCTCCCAGGTTCAGG + Intronic
959058601 3:101594802-101594824 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
959077117 3:101760942-101760964 AACCTCTGCCTCCCAGGTTCAGG + Intronic
959701792 3:109305690-109305712 AACCTCTGCCTCCCAGGTTCAGG - Intronic
959748899 3:109810081-109810103 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
959773024 3:110122835-110122857 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
960527309 3:118724334-118724356 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
960591140 3:119367018-119367040 AACCTCTGCCTCCCAGGTTCAGG - Intronic
960797563 3:121503932-121503954 AACCTCTGCCTCCCAGGTTCAGG + Intronic
960881762 3:122352578-122352600 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
961060018 3:123820803-123820825 AACCTCTGCCTCCCAGGTTCAGG + Intronic
961252444 3:125518929-125518951 AACCTCTGCCTCCCAGGTTCAGG - Intronic
961610620 3:128134378-128134400 AACCTCTGCCTCCCAGGTTCAGG - Intronic
961707843 3:128802884-128802906 AACCTCTGCCTCCCCGATTCAGG + Intronic
961765689 3:129208927-129208949 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
961766271 3:129213667-129213689 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
961854560 3:129856998-129857020 AACCTCTGCCTCCCAGGTTCAGG + Intronic
961941864 3:130646490-130646512 AACCTCTGCCTCCCAGGTTCAGG - Intronic
962515331 3:136144577-136144599 AACCTCTGCCTCCCAGGTTCAGG - Intronic
962561738 3:136613566-136613588 AACCTCTGCCTCCCAGGTTCAGG + Intronic
962598490 3:136971210-136971232 AACCTCTGCCTCCCAGGTTCAGG + Intronic
962731574 3:138288717-138288739 AACCTCTGCCTCCCAGGTTCAGG + Intronic
963649197 3:147956394-147956416 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
963731880 3:148982502-148982524 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
964974506 3:162602645-162602667 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
965143730 3:164870628-164870650 AACCTCTGCCTCCCGGGTTCTGG - Intergenic
965498807 3:169432238-169432260 AACCTCTGCCTCCCAGGTTCAGG + Intronic
965572802 3:170188631-170188653 AACCTCTGCCTCCCGGATTCAGG + Intergenic
966086001 3:176067714-176067736 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
966088610 3:176102605-176102627 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
966159481 3:176952986-176953008 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
966183257 3:177205484-177205506 AACTTCTGCCTCCCGGCTTCAGG - Intergenic
966203946 3:177387101-177387123 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
966386037 3:179399282-179399304 AACCTCTGCCTCCCGGGTTCAGG + Exonic
966787487 3:183634880-183634902 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
966833919 3:184034744-184034766 AACCTCTGCCTCCCAGGTTCAGG - Intronic
966872040 3:184297050-184297072 AACCTCTGCCTCCCGGGTTCAGG - Intronic
966873379 3:184307024-184307046 AACCTCTGCCTCCCGGGTTCAGG + Intronic
967028930 3:185587814-185587836 AACCTCTGCCCACTGGGTTCAGG + Intronic
967104431 3:186243976-186243998 AACCTCTGCCTCCCAGGTTCAGG + Intronic
967178320 3:186881560-186881582 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
967230987 3:187337275-187337297 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
967304889 3:188050712-188050734 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
967756099 3:193170418-193170440 AACCTCTGCCTCCCAGGTTCCGG - Intergenic
967802043 3:193672785-193672807 AACCTCTGCCTCCCGGGTTCAGG - Intronic
968079456 3:195836049-195836071 CACCACCGCCCTCCCGCATCAGG + Intergenic
968082250 3:195854544-195854566 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
968215075 3:196882583-196882605 AACCTCTGCCTCCCAGGTTCAGG + Intronic
968270417 3:197399202-197399224 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
968326793 3:197824646-197824668 AACCTCTGCCCCCCCGTCCCGGG + Intronic
968606575 4:1538327-1538349 CACCACTGCCCTCCCACTGCTGG - Intergenic
968677019 4:1888329-1888351 AACCTCTGCCTCCCAGGTTCAGG - Intronic
969082481 4:4629798-4629820 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
969147021 4:5132878-5132900 AACCTCTGCCTTCTGGGTTCAGG + Intronic
969178710 4:5420979-5421001 AACCTCTGCCTCCCAGGTTCAGG + Intronic
969392744 4:6901956-6901978 AGCCGCTGCCCTTCCTCTTCAGG - Intergenic
969400605 4:6953105-6953127 ACCCTCTGCCTTCCAGCTTCAGG + Intronic
969777791 4:9371559-9371581 AACCTCTGCCTCCCAGATTCAGG - Intergenic
969851339 4:9959308-9959330 AACCTCTGCCTCCCAGGTTCAGG - Intronic
970293680 4:14604715-14604737 AACCTCTGCCCTCTGGGTTTTGG + Intergenic
970567397 4:17346044-17346066 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
970702407 4:18757753-18757775 AACCTCTGCCTCCCAGATTCAGG - Intergenic
970881140 4:20933160-20933182 AACCTCTGCCTTCCAGGTTTAGG - Intronic
971204665 4:24553237-24553259 AACCTCTGCCTCCCAGGTTCAGG - Intronic
971322991 4:25620479-25620501 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
971339247 4:25752700-25752722 AGCCTCTGCCTCCCAGCTTCAGG + Intronic
971397693 4:26244707-26244729 AACCTCTGCCTCCCAGGTTCAGG + Intronic
971491668 4:27218927-27218949 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
972001079 4:34034189-34034211 TACCTCTACCCTTCCACTTCTGG - Intergenic
972376052 4:38471457-38471479 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
972380766 4:38517933-38517955 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
972424189 4:38917254-38917276 AACCTCTGCCTCCCAGGTTCAGG - Intronic
972436123 4:39037182-39037204 AACCTCCGCCTTCCAGGTTCAGG + Intergenic
972441212 4:39093822-39093844 AACCTCTGCCTCCCAGGTTCAGG - Intronic
972502735 4:39693574-39693596 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
972529867 4:39951816-39951838 AACCTCTGCCTTCCGGGTTCAGG - Intronic
972595917 4:40529745-40529767 AACCTCCGCCTTCCGGGTTCAGG - Intronic
972601130 4:40573646-40573668 AACCTCTGCCTCCCGGGTTCAGG - Intronic
972635604 4:40881613-40881635 AACCTCTGCCTCCCAGGTTCAGG + Intronic
973676753 4:53271542-53271564 AACCTCTGCCTCCCAGGTTCAGG + Intronic
973699582 4:53523366-53523388 AACCTCTGCCTCCCAGGTTCAGG + Intronic
973900812 4:55469205-55469227 AACCTCTGCCTCCCAGGTTCAGG + Intronic
974191658 4:58512532-58512554 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
974198976 4:58614200-58614222 AACCTCCGCCTTCCAGGTTCAGG - Intergenic
974722827 4:65764392-65764414 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
974975180 4:68882561-68882583 AACCTCTGCCTCCCCGGTTCAGG + Intergenic
975008070 4:69315240-69315262 AACCTCCGCCTTCCAGGTTCAGG + Intronic
975346346 4:73296428-73296450 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
975742961 4:77448398-77448420 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
975787299 4:77905413-77905435 AACCTCTGCCTCCCAGGTTCAGG - Intronic
975849295 4:78555121-78555143 AACCTCTGCCTCCCAGGTTCAGG - Intronic
975866833 4:78732427-78732449 AACCTCTGCCCTCTGGGTTCAGG - Intergenic
976028755 4:80725024-80725046 AACCTCTGCCTCCCAGGTTCAGG + Intronic
976240783 4:82954497-82954519 AACCTCTGCCTCCCCAGTTCAGG + Intronic
977202467 4:94133015-94133037 AACCTCAGCCTTCCAGGTTCCGG + Intergenic
977273455 4:94946968-94946990 AACCTCTGCCTCCCCGGTTCAGG - Intronic
977352142 4:95902254-95902276 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
978710897 4:111779652-111779674 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
979804565 4:124955031-124955053 AACCTCTGCCTACCGGGTTCAGG - Intergenic
980057167 4:128089415-128089437 AACCTCTGCCTCCCAGGTTCAGG + Intronic
980484743 4:133441095-133441117 AACCTCTGCCTACCTGGTTCAGG + Intergenic
980992192 4:139747610-139747632 AACCTCCACCCTCCCGGTTCAGG - Intronic
981703326 4:147632089-147632111 AACCTCTGCCTTCTGGGTTCAGG - Intronic
981997849 4:150993981-150994003 AACCTCTGCCTCCCAGGTTCAGG - Intronic
982726325 4:158910353-158910375 AACCTCTGCCTCCCGGGTTCAGG + Intronic
982757126 4:159234462-159234484 AACCTCTGCCTTCCGGGTTCAGG + Intronic
983581029 4:169310073-169310095 AACCTCCGCCCTCCAGGTTCAGG - Intergenic
983591273 4:169413933-169413955 AACCTCTGCCCTCTGGGTTCAGG - Intronic
983604340 4:169568853-169568875 AACCTCTGCCTCCCAGGTTCAGG - Intronic
984111211 4:175616954-175616976 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
984152563 4:176152522-176152544 AACCTCTGCCTCCCAGGTTCAGG - Intronic
984263491 4:177470036-177470058 AACCTCTGCCTCCCTGGTTCAGG + Intergenic
984588178 4:181586756-181586778 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
984730921 4:183067170-183067192 AACCTCTGCCTCCCTGATTCAGG - Intergenic
984755774 4:183324461-183324483 AACCTCTGCCTCCCCGGTTCAGG - Intergenic
984759776 4:183353567-183353589 AACCTCTGCCTCCCGGATTCAGG - Intergenic
984791571 4:183619584-183619606 AACCTCCCCCCTCCCCCTGCAGG - Intergenic
984994030 4:185410564-185410586 AACCTCTGCCTCCCTGGTTCAGG - Intronic
985004118 4:185515980-185516002 AACCTCCGCCTCCCCGGTTCAGG + Intronic
985041586 4:185896500-185896522 AACCTCTGCCTCCCGGATTCAGG - Intronic
985282890 4:188304578-188304600 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
985347157 4:189018094-189018116 ACCTTCTGCCCACCTGCTTCTGG - Intergenic
986115939 5:4774864-4774886 AACTTCTGCCAGCCCGTTTCTGG + Intergenic
986171363 5:5317474-5317496 AACCTCTGCCTCCCAGGTTCAGG + Intronic
986247680 5:6025568-6025590 AAGCTCTGCCTTCCGGGTTCAGG + Intergenic
986682461 5:10246351-10246373 AACCTCTGCCTCCCCGGTTCAGG - Intronic
986855568 5:11864974-11864996 AACCTCTGCCTCCCGGGTTCAGG + Intronic
986997994 5:13629054-13629076 AACATCTGCCTCCCCGGTTCAGG - Intergenic
987021258 5:13874597-13874619 AACCTCTGCCTTCTAGATTCAGG + Intronic
987146498 5:14995844-14995866 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
987637666 5:20566439-20566461 AACCTCTGCCTTCCAGGTTCAGG + Intronic
987667622 5:20965126-20965148 AACCTCCGCCTCCCCGGTTCAGG - Intergenic
988083297 5:26440532-26440554 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
988458069 5:31405291-31405313 AACCTCTGCCTCCCCGGTCCAGG - Intronic
988721391 5:33882671-33882693 AACCTCCGCCTTCCAGGTTCAGG + Intronic
988831126 5:34988348-34988370 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
988914700 5:35880842-35880864 AACCTCTGCCTTCCAGGTTCAGG + Intergenic
989063177 5:37430933-37430955 AACCTCTGCCTCCCGGGTTCAGG + Intronic
989163761 5:38415279-38415301 AACCTCTGCCTCCCAGGTTCAGG - Intronic
989334044 5:40293783-40293805 AACCTCTGCCTCCCGGTTTCAGG + Intergenic
989575356 5:42982819-42982841 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
989803288 5:45571830-45571852 AACCTCTGCCTCCCAGGTTCAGG - Intronic
990221283 5:53592018-53592040 AACCTCTGCCTCCCAGGTTCAGG + Intronic
990305291 5:54488740-54488762 AACCTCTGCCCCCTAGGTTCAGG + Intergenic
990402343 5:55451641-55451663 AACCTCTGCCTTCCGGGTTCAGG + Intronic
990881476 5:60543741-60543763 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
991013305 5:61906376-61906398 CACATCTGCACTCCAGCTTCTGG + Intergenic
991316606 5:65315991-65316013 AACCTCTGCCTCCCGGGTTCAGG + Intronic
991344175 5:65645114-65645136 AACCTCTGCCTACCAGGTTCAGG - Intronic
991738479 5:69647832-69647854 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
991759715 5:69908595-69908617 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
991787617 5:70209521-70209543 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
991790054 5:70227571-70227593 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
991814802 5:70502666-70502688 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
991817938 5:70523947-70523969 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
991838945 5:70783662-70783684 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
991880062 5:71209889-71209911 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
991882502 5:71227914-71227936 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
991915208 5:71598519-71598541 AACCTCTGCCTTCCGGATTCAGG + Intronic
991967410 5:72107136-72107158 CACCTCGTCCCTCCAGCTTCCGG + Intergenic
992432144 5:76719505-76719527 AACCTCTGCCTTCCAGGTTCAGG - Intronic
992452968 5:76890103-76890125 AACCTCTGCCTCCCAGGTTCAGG + Intronic
992585739 5:78237729-78237751 AACCTCTGCCTGCCGGGTTCAGG - Intronic
992603082 5:78424636-78424658 AACCTCTGCCTCCCGGGTTCAGG - Intronic
992635955 5:78726305-78726327 AACCTCTGCCTCCCAGGTTCAGG + Intronic
992688012 5:79216896-79216918 AACCTCTGCCTCCCAGGTTCAGG + Intronic
992689546 5:79229246-79229268 AACTTCTGCCATCCCTCTCCAGG - Intronic
992728848 5:79637877-79637899 AACCTCTGCCTTCCGGGTTCAGG + Intronic
992971465 5:82063572-82063594 AACCTCTGCCTCCCAGGTTCAGG + Intronic
993190860 5:84678801-84678823 AACCTCTGCCTCCCAGTTTCAGG + Intergenic
993295261 5:86130599-86130621 AACCTCTGCCTCCCAGATTCAGG + Intergenic
993396766 5:87398889-87398911 AAGCTCTGCCTTCCAGGTTCAGG - Intronic
993420059 5:87690330-87690352 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
993499812 5:88652836-88652858 AACCTCCGCCTTCCAGGTTCAGG + Intergenic
993702168 5:91131530-91131552 AACCTCTGCCTTCTGGGTTCAGG + Intronic
994374042 5:98997799-98997821 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
994529112 5:100944926-100944948 AACCTCTGCCTCTCCGGTTCAGG + Intergenic
994823252 5:104680197-104680219 AACCTCTGCCTGCCGGGTTCAGG - Intergenic
994960046 5:106587873-106587895 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
995082961 5:108075555-108075577 AACCTCTGCCTCCCGGGTTCAGG + Intronic
995141980 5:108745119-108745141 AACCTCCGCCTTCCAGGTTCAGG - Intergenic
995147194 5:108799922-108799944 AACCTCTGCCTCCCGGGTTCAGG + Intronic
995619274 5:114005656-114005678 AACATCTGCCCTCCAGGTTCAGG - Intergenic
995653327 5:114396628-114396650 AACCTCTGCCTCCCAGGTTCAGG + Intronic
995728932 5:115215378-115215400 AACCTCTGCCTCCCAGGTTCAGG + Intronic
996075279 5:119185582-119185604 AACCTCTGCCTCCCAGGTTCAGG + Intronic
996251993 5:121346795-121346817 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
996376896 5:122820452-122820474 AACCTCTGACTCCCCGGTTCAGG - Intronic
996720145 5:126622213-126622235 AACCTCTGCCTCCCGGGTTCAGG + Intronic
996904755 5:128585696-128585718 AACCTCTGCCTCCCGGGTTCAGG + Intronic
997119005 5:131155252-131155274 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
997140453 5:131374447-131374469 AACCTCTGCCACCCGGGTTCAGG - Intronic
997277596 5:132609698-132609720 AACCTCTGCCTCCCAGGTTCAGG - Intronic
997574503 5:134963899-134963921 AACCTCTGCCTCCCAGGTTCAGG + Intronic
997736001 5:136213086-136213108 CACCTGTGCCCTCCCACTGCAGG - Intergenic
997911112 5:137874383-137874405 AACCTCTGCCTCCCGGGTTCAGG - Intronic
997915576 5:137921277-137921299 AACCTCTGTCTTCCAGGTTCAGG - Intronic
997938792 5:138137921-138137943 AACCTCTGCCTTCCAGGTCCCGG - Intronic
998000216 5:138619132-138619154 AACCTCCGCCTTCCGGGTTCAGG - Intronic
998024136 5:138799240-138799262 AACCTCTGCCTTCCGGGTTCAGG + Intronic
998044359 5:138974336-138974358 CACCTCTGTCCTCCCCCTTTGGG + Intronic
998082385 5:139287535-139287557 AACCTCCGCCCACCGGGTTCAGG - Intronic
998135489 5:139672197-139672219 AACCTCTGCCTCCCAGGTTCAGG + Intronic
998224784 5:140318579-140318601 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
998247865 5:140525342-140525364 AACCTCTGCCCCCCAGGTTCAGG + Intronic
998342308 5:141428934-141428956 AAGCTCTGCCTTCCGGGTTCTGG + Intronic
998346424 5:141468241-141468263 AACCTCTGCCTCCCAGGTTCAGG - Intronic
998495431 5:142584364-142584386 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
998621592 5:143800526-143800548 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
998666957 5:144308436-144308458 AACACCTGCCCACCCGCCTCAGG - Intronic
998724307 5:144992083-144992105 AACCTCTGCCTTCCAGGTTCAGG + Intergenic
998943537 5:147312180-147312202 AACCTCTGCCCCCCAGGTTCAGG + Intronic
999219543 5:149963358-149963380 AACCTCTGCCTCCCAGGTTCAGG + Intronic
999243623 5:150141501-150141523 AATCTCTGCTCTACCCCTTCTGG - Intronic
999492043 5:152060689-152060711 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
999508090 5:152219082-152219104 ATCCTCTCCCCTCCCACCTCTGG - Intergenic
999780137 5:154842602-154842624 AACCTCTGCCTCCCAGGTTCAGG + Intronic
999930851 5:156431795-156431817 AACCTCTGCCTCCCCAGTTCAGG + Intronic
999999883 5:157127839-157127861 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1000309188 5:160025107-160025129 AACCTCTGCCTCCCAGGTTCTGG + Intronic
1000317380 5:160105454-160105476 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1000544014 5:162576770-162576792 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1000668518 5:164029262-164029284 AACATTTGCACTCTCGCTTCTGG + Intergenic
1000899403 5:166894719-166894741 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1001389171 5:171364998-171365020 AACCTCTGCCTCCCGGGTTCTGG - Intergenic
1001507645 5:172292680-172292702 AACCTCTGCCTCCCGGGTTCGGG + Intergenic
1001540912 5:172538265-172538287 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1001585615 5:172832256-172832278 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1001611951 5:173009843-173009865 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1001964211 5:175899131-175899153 AACCTCTGCCTCCCTGGTTCAGG + Intergenic
1002293005 5:178212334-178212356 AACCTGTGCCCTCCTACCTCTGG - Intronic
1002311680 5:178318818-178318840 AACCTCTGCCTCCCAGATTCAGG - Intronic
1002449304 5:179309960-179309982 CACCCCTGCCCTCTGGCTTCTGG + Intronic
1002504914 5:179672718-179672740 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1002646601 5:180659496-180659518 AACCTCTGCCCCCCGGGTTCAGG - Intergenic
1002817917 6:696080-696102 AACCTCTGCCCTCGTGCAACAGG - Intergenic
1003205636 6:4007857-4007879 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1003217896 6:4131773-4131795 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1003238118 6:4316898-4316920 CACCTCTGCCCACATGCTTCTGG + Intergenic
1003280345 6:4685786-4685808 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1003415068 6:5899693-5899715 CTTCTCTGCCCTCCCACTTCAGG + Intergenic
1003504303 6:6727271-6727293 AACCTCTGCCTCCCAGATTCAGG + Intergenic
1003560215 6:7173737-7173759 AACCTCTGCCTCCCTGGTTCAGG - Intronic
1003656555 6:8016242-8016264 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1003659918 6:8050682-8050704 AACCTCTGCCGCCCAGGTTCAGG + Intronic
1003788120 6:9510876-9510898 AGCCTCTGCCTTCCTGGTTCTGG + Intergenic
1003959141 6:11192849-11192871 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1004174033 6:13323269-13323291 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1004452598 6:15760584-15760606 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1004456397 6:15795730-15795752 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1004618450 6:17312714-17312736 AACCTCTGCTCCCCAGGTTCAGG + Intergenic
1004706636 6:18130201-18130223 AACCTCTGCCTCCCAGGTTCAGG - Exonic
1005763311 6:28987262-28987284 AACCTCTGCCTCCCGGGTTCCGG - Intergenic
1005969640 6:30751100-30751122 AACCTCTGCCTCCCTGGTTCAGG - Intergenic
1005969655 6:30751251-30751273 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1006000438 6:30960765-30960787 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1006331856 6:33397377-33397399 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1006491229 6:34390210-34390232 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1006564885 6:34947225-34947247 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1006622755 6:35377943-35377965 AACCTCTGCCTTCTGGGTTCAGG + Intronic
1006671808 6:35734239-35734261 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1006687412 6:35847907-35847929 AACCTCTGCCTCCCAGCCTCAGG + Intronic
1006689392 6:35867733-35867755 AACCTCTGCCTCCCGGATTCAGG - Intronic
1006768159 6:36527108-36527130 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1006937881 6:37731094-37731116 CACCACTGCCCTCCAGCTTGGGG - Intergenic
1006949791 6:37812283-37812305 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1006975679 6:38098580-38098602 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1007388173 6:41533384-41533406 AACCTCTGCCTCCCTGGTTCTGG - Intergenic
1007488892 6:42202444-42202466 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1007594717 6:43044415-43044437 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1007755801 6:44098653-44098675 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1008094138 6:47321461-47321483 AACCTCTGCCGCCCGGGTTCAGG - Intergenic
1008314411 6:50022591-50022613 AACCTCTGCCTTCCAGGTTCAGG + Intergenic
1008859202 6:56128734-56128756 AACCTCTGCCCCCCAGGCTCAGG + Intronic
1009247620 6:61258882-61258904 AACCTCTGCCACCCAGATTCAGG - Intergenic
1010162820 6:72878186-72878208 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1010228130 6:73510818-73510840 AACCTCTGCCTTCCAGGTTCAGG - Intergenic
1010423314 6:75698927-75698949 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1011067805 6:83347033-83347055 AACCTCTGCCTACCGGGTTCAGG + Intronic
1011460591 6:87599447-87599469 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1011644054 6:89441230-89441252 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1011669243 6:89666345-89666367 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1011864184 6:91801727-91801749 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1011901862 6:92308531-92308553 AACCTCTGCCTCCTGGCTTCAGG + Intergenic
1012110460 6:95224572-95224594 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1012254750 6:97018517-97018539 AACCTCTGCCTCCCTGGTTCAGG - Intronic
1012785104 6:103614792-103614814 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1013123058 6:107157750-107157772 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1013147636 6:107410568-107410590 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1013262834 6:108463205-108463227 AACCTCTGCCTTGCAGGTTCAGG - Intronic
1013522214 6:110943740-110943762 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1013529247 6:111003892-111003914 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1013581172 6:111536037-111536059 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1013587077 6:111589140-111589162 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1014412608 6:121145448-121145470 ATACCCTGCCCTCCAGCTTCTGG - Intronic
1014978747 6:127921578-127921600 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1015408536 6:132865100-132865122 AACCTCTGCCATGCTGATTCAGG - Intergenic
1015478657 6:133682394-133682416 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1015740729 6:136450700-136450722 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1016208136 6:141495660-141495682 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1016373608 6:143398474-143398496 AACCTCTGCCTCCCTGATTCAGG - Intergenic
1016465199 6:144318543-144318565 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1016480795 6:144479198-144479220 AACCTCTGCCACCCAGGTTCAGG + Intronic
1016682618 6:146848647-146848669 AACCTCTGCCCCCTGGTTTCAGG + Intergenic
1016734616 6:147463385-147463407 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1017034759 6:150257363-150257385 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1017075304 6:150612412-150612434 AACCTCTGCCTCCCGGATTCCGG + Intronic
1017084033 6:150697013-150697035 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1017103588 6:150867877-150867899 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1017145573 6:151231274-151231296 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1017175386 6:151497892-151497914 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1017184111 6:151583537-151583559 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1017185294 6:151594731-151594753 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1017301809 6:152869379-152869401 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1017502374 6:155037608-155037630 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1017510045 6:155106084-155106106 AACCTCTGCCCCCTGGGTTCAGG + Intronic
1017513613 6:155136354-155136376 AACCTCTGCCTTCCAGGTTCAGG + Intronic
1017539949 6:155390804-155390826 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1017714086 6:157195977-157195999 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1017722497 6:157253641-157253663 AAGCTCTGCCCCCCTGGTTCAGG - Intergenic
1018196915 6:161363158-161363180 AACCTCTGCCCCCCAGGTTCAGG - Intronic
1018270505 6:162072204-162072226 AACCTCTGCCTCCCTGGTTCAGG - Intronic
1018471982 6:164105595-164105617 ATCCCCTCCCCTCCCGCTGCAGG - Intergenic
1018697304 6:166400539-166400561 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1019924568 7:4183557-4183579 AACCTCTGCCTCCCGGGTTCCGG - Intronic
1020061147 7:5153528-5153550 AACCTCTGCCTCCCAGGTTCTGG + Intergenic
1020103830 7:5411434-5411456 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1020126499 7:5535587-5535609 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1020377237 7:7501975-7501997 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1020669723 7:11091674-11091696 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1020670173 7:11097059-11097081 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1021112800 7:16714594-16714616 AACTTCTGCCTTCCGGGTTCAGG - Intergenic
1021240902 7:18199886-18199908 CACCACTGCCCTCCAGCTTGGGG + Intronic
1021328189 7:19300616-19300638 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1021844346 7:24749418-24749440 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1021985787 7:26097459-26097481 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1021987385 7:26109987-26110009 AACCTCTGCCCCCCGGGCTCAGG - Intergenic
1022000123 7:26218360-26218382 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1022006681 7:26271983-26272005 AAGCTCTGCCTCCCGGCTTCAGG - Intergenic
1022130750 7:27402349-27402371 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1022300707 7:29099628-29099650 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1022501474 7:30884677-30884699 AACCTCTCCACTGCCTCTTCTGG + Intronic
1022707556 7:32818722-32818744 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1022940545 7:35232936-35232958 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1022981308 7:35607230-35607252 AAGCTCTGGCCTCCTCCTTCCGG - Intergenic
1023061607 7:36332843-36332865 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1023064081 7:36358114-36358136 AACCTCTGCCTCCCGGATTCAGG - Intronic
1023411280 7:39891398-39891420 AACCTCTGCCTTCCAGATTCAGG - Intergenic
1023441495 7:40189258-40189280 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1023738268 7:43253824-43253846 AACCTCTGCCTTCCAGGTTCAGG - Intronic
1023883140 7:44332805-44332827 AACCTCCGCCCACCGGGTTCAGG - Intronic
1024168766 7:46762640-46762662 AATCTCTGCCCTCCATTTTCAGG - Intergenic
1024464090 7:49691932-49691954 AACCTCTGCCACCCAGGTTCAGG + Intergenic
1024851263 7:53720185-53720207 AACCTCTGCCTCCCGGATTCAGG + Intergenic
1024858369 7:53808139-53808161 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1025159555 7:56643154-56643176 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1026018562 7:66691007-66691029 AACCCCTGCCTCCCCGGTTCCGG - Intronic
1026177110 7:68007661-68007683 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1026285828 7:68962051-68962073 AGCCTCTGCCTTCCTGGTTCAGG - Intergenic
1026325916 7:69310375-69310397 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1026902720 7:74045951-74045973 AACCTCTGCCTCCCAGGTTCTGG - Intronic
1027226614 7:76247774-76247796 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1027234484 7:76289916-76289938 AACCTCTGCCTTCCAGGTTCAGG - Intergenic
1027535768 7:79399174-79399196 AAACTCTGCCTCCCCGGTTCAGG + Intronic
1027802197 7:82768339-82768361 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1028040975 7:86053993-86054015 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1028806632 7:95034448-95034470 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1028831577 7:95333190-95333212 AACCTCTGCCTTCTGGTTTCAGG - Intergenic
1028925245 7:96350498-96350520 AACCTCTGCCTCCCAGGTTCCGG + Intergenic
1029143816 7:98431357-98431379 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1029165028 7:98582328-98582350 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1029415435 7:100440190-100440212 AACCTCCGCCTCCCAGCTTCAGG - Intergenic
1029426288 7:100496031-100496053 AACCTCTGCCTCCCGGGTTCTGG - Intergenic
1029450233 7:100637510-100637532 AACCTCCGCCTCCCGGCTTCAGG - Intronic
1029541651 7:101186626-101186648 AACCTTTGCCCCCCGGGTTCAGG + Intergenic
1029589405 7:101497154-101497176 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1029982550 7:104892627-104892649 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1030029519 7:105355964-105355986 AACTTCTGCCTTCCAGTTTCAGG - Intronic
1030034144 7:105394222-105394244 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1030230125 7:107199165-107199187 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1030306944 7:108028556-108028578 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1030350701 7:108482388-108482410 AACCTCTGCCTCCCTGGTTCAGG - Intronic
1030861849 7:114641885-114641907 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1030987769 7:116262690-116262712 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1031024727 7:116667738-116667760 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1031042751 7:116855952-116855974 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1031044253 7:116869949-116869971 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1031354087 7:120768684-120768706 AACCTCTGCCTTCCGGGCTCAGG - Intergenic
1031716754 7:125117656-125117678 AACCTCTGCCCCCTGGGTTCAGG - Intergenic
1031773829 7:125881442-125881464 AACCTCTGCCTCCCAGATTCAGG + Intergenic
1032027193 7:128453271-128453293 AACCTCTGCCTGCCAGGTTCAGG + Intergenic
1032040581 7:128557399-128557421 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1032152545 7:129442141-129442163 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1032162171 7:129519376-129519398 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1032201339 7:129825208-129825230 CCGCTCGGCCCTCCCGCTTCAGG + Intergenic
1032212991 7:129932690-129932712 AACCTCCGCCTTCCGGGTTCAGG - Intronic
1032232627 7:130088722-130088744 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1032320333 7:130880477-130880499 AACCTCTGCCACCCGGGTTCAGG - Intergenic
1032328870 7:130958677-130958699 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1032344402 7:131106058-131106080 GCCCTCTGCCCTCCCGCCCCCGG - Intergenic
1032424089 7:131806552-131806574 AGCCTCTGCTCTCCAGCTCCTGG - Intergenic
1032856159 7:135835230-135835252 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1033279236 7:139994121-139994143 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1033315881 7:140297107-140297129 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1033346322 7:140527914-140527936 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1033464268 7:141576956-141576978 AAGCTCTGCCTTCCAGGTTCAGG - Intronic
1033755213 7:144392957-144392979 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1034346937 7:150391791-150391813 AACCTCTGCCTCCCTGGTTCGGG + Intronic
1034430431 7:151038617-151038639 AGCCCCAACCCTCCCGCTTCGGG + Intronic
1034631294 7:152532527-152532549 AACCTCTGCCCCCCAGGTTCAGG + Intergenic
1034836577 7:154357858-154357880 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1034861830 7:154602497-154602519 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1034867462 7:154654498-154654520 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1035215230 7:157361238-157361260 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1035535610 8:388864-388886 AACCTCCGCCTTCCGGGTTCAGG + Intergenic
1036469708 8:9041814-9041836 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1036702800 8:11024323-11024345 AACCTCTGCCCTCCCCAGTTGGG + Intronic
1036771898 8:11584622-11584644 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1037274377 8:17161776-17161798 AGCCTCTGCCTCCCCGGTTCAGG - Intronic
1037845035 8:22275501-22275523 GGCCTCTCCCCTCCCACTTCGGG + Intronic
1037985929 8:23290487-23290509 CACCTCCGCCCTCCCTTTTCGGG - Intronic
1038544954 8:28418771-28418793 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1038621955 8:29152691-29152713 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1038633683 8:29268619-29268641 AACCTCTGCCTCCCAGGTTCCGG + Intergenic
1038736059 8:30170721-30170743 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1038769764 8:30466674-30466696 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1039122681 8:34165989-34166011 AACTTCTGCCCTTCTGTTTCAGG + Intergenic
1039312262 8:36330045-36330067 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1039358172 8:36844296-36844318 AACCTCTGCCTTCCAGGTTCAGG - Intronic
1039530293 8:38255111-38255133 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1039622485 8:39011009-39011031 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1039700630 8:39958281-39958303 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1039869227 8:41531188-41531210 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1039933627 8:42018837-42018859 AACCTCTGCCTCCCCAGTTCAGG - Intronic
1040030737 8:42821426-42821448 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1040037420 8:42884160-42884182 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1040408317 8:47131075-47131097 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1040504907 8:48038558-48038580 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1041232059 8:55763467-55763489 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1041669388 8:60477644-60477666 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1041695761 8:60734506-60734528 ACCCTCAACCCTCCCTCTTCAGG - Intronic
1042140361 8:65672590-65672612 AACCTCTGCCTTCTGGGTTCAGG + Intronic
1042257219 8:66817347-66817369 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1042487529 8:69362872-69362894 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1042556516 8:70037995-70038017 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1042787187 8:72561236-72561258 AACCTCTGCCTCCCAGGTTCTGG + Intronic
1042796279 8:72666732-72666754 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1043468496 8:80538110-80538132 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1043582151 8:81726785-81726807 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1043929937 8:86079381-86079403 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1044247429 8:89965568-89965590 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1044419941 8:91983007-91983029 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1044505284 8:93009525-93009547 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1044598901 8:93984336-93984358 CACCTCCACCCTCCCTCTTCTGG + Intergenic
1044691857 8:94888604-94888626 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1045000417 8:97873428-97873450 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1045014916 8:97992662-97992684 AACCTCTGCCGCCCAGGTTCAGG - Intronic
1045131426 8:99158449-99158471 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1045140288 8:99273238-99273260 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1045223763 8:100224458-100224480 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1045236489 8:100356920-100356942 AACCTCCGCCCCCCAGGTTCAGG + Intronic
1045284202 8:100775816-100775838 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1045397504 8:101775590-101775612 TACCTCTCCCCTCAGGCTTCTGG + Intronic
1045466753 8:102477168-102477190 AACCTCTGCCTCCCGGATTCAGG - Intergenic
1045685073 8:104703267-104703289 AAGCTCTGCTCTCAGGCTTCTGG - Intronic
1045963042 8:107991163-107991185 AACCTCTGCCTTCCAGGTTCAGG - Intronic
1046077563 8:109331432-109331454 AACCTCTGCCTTCCGGGTTCAGG - Intronic
1046134267 8:110006077-110006099 AACCTCTGCCTCCCAGCTTCAGG + Intergenic
1046403477 8:113739908-113739930 AACCTCTGCCTCCCTGGTTCAGG + Intergenic
1046840304 8:118849075-118849097 AACCTCTTCCCTCCCTTTACTGG + Intergenic
1046911107 8:119627778-119627800 AACCTCTGCCTCCCAGGTTCGGG - Intronic
1047004376 8:120604533-120604555 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1047084483 8:121500900-121500922 AACCTCCGCCTTCCAGGTTCAGG - Intergenic
1047091450 8:121579985-121580007 AACCTCTGCCTTCCAGGTTCAGG + Intergenic
1047342857 8:123999579-123999601 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1047726682 8:127689981-127690003 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1047786620 8:128159514-128159536 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1048338483 8:133520851-133520873 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1048358662 8:133675407-133675429 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1048482471 8:134812060-134812082 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1049019740 8:139947784-139947806 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1049088520 8:140495984-140496006 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1049122950 8:140756239-140756261 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1049738930 8:144225631-144225653 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1049837176 8:144744093-144744115 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1050173606 9:2847591-2847613 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1050518897 9:6476674-6476696 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1050556813 9:6796368-6796390 AACCTCTGCCCTCCACCTCCCGG - Intronic
1050849639 9:10267107-10267129 AACCTCTGCCCCCCGAGTTCAGG - Intronic
1051067116 9:13117924-13117946 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1051224314 9:14882829-14882851 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1051282461 9:15455954-15455976 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1051293218 9:15567101-15567123 AACCTCTGTCCCCCGGGTTCAGG + Intronic
1051302544 9:15667562-15667584 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1051341556 9:16116484-16116506 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1051765164 9:20515026-20515048 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1052120599 9:24710949-24710971 AACCTCCACCTTCCGGCTTCAGG - Intergenic
1052293417 9:26870696-26870718 AACCTCTGCCTCCCCGGTTCAGG + Intronic
1052331460 9:27273809-27273831 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1052334208 9:27303372-27303394 TCTCTCTGCCCTCCCTCTTCTGG + Intergenic
1052678697 9:31660143-31660165 AACCTCTGCCTCCCAGGTTCCGG + Intergenic
1052716048 9:32118667-32118689 ACCCTGAGCCCTCCAGCTTCTGG + Intergenic
1052749964 9:32479753-32479775 AACCTCTGCCTCCCGGATTCAGG - Intronic
1052757586 9:32556931-32556953 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1052909025 9:33863428-33863450 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1052944467 9:34156858-34156880 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1052971202 9:34378165-34378187 AAGCTATCCCCTCCCGCCTCAGG + Intergenic
1053007144 9:34612034-34612056 CCCCTCTGCCCGCCCGGTTCCGG + Exonic
1053091713 9:35284182-35284204 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1053224896 9:36346285-36346307 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1053254475 9:36604358-36604380 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1053475531 9:38379544-38379566 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1053709617 9:40792582-40792604 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1054419521 9:64913370-64913392 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1054715846 9:68557198-68557220 AACCACTGTCATCCCACTTCTGG + Intergenic
1054777438 9:69135520-69135542 AACCTCTGCCTCCCGGATTCAGG + Intronic
1055123071 9:72685443-72685465 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1055322931 9:75099745-75099767 AACCTCCGCCTTCCAGGTTCAGG - Intronic
1055495452 9:76850128-76850150 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1055520463 9:77075819-77075841 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1055528007 9:77154879-77154901 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1055565663 9:77566234-77566256 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1056167097 9:83950129-83950151 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1056180065 9:84074147-84074169 AACCTCTGCCTCCCGGGTTCGGG + Intergenic
1056216684 9:84411597-84411619 AGCCTCTGCCCTTCGGCCTCTGG - Intergenic
1056279675 9:85029105-85029127 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1056364470 9:85889746-85889768 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1056647056 9:88422789-88422811 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1056739549 9:89242523-89242545 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1056850815 9:90082224-90082246 AGCCTCAGCTCTCCTGCTTCTGG - Intergenic
1056858897 9:90161476-90161498 AACCTCCGCCATCCAGGTTCAGG - Intergenic
1057052899 9:91939166-91939188 AACCTCTGCCTTCCGGGTTCAGG - Intronic
1057084653 9:92197807-92197829 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1057100751 9:92357574-92357596 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1057107986 9:92438869-92438891 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1057156174 9:92841923-92841945 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1057201164 9:93140726-93140748 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1057278976 9:93697134-93697156 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1057347717 9:94266002-94266024 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1057406408 9:94775449-94775471 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1057412429 9:94828948-94828970 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1057576810 9:96248985-96249007 AACCTCTGCCTGCCTGGTTCAGG + Intronic
1057611633 9:96548717-96548739 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1057759725 9:97862426-97862448 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1057788125 9:98103754-98103776 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1058123414 9:101164442-101164464 AACCTCTGCCTCCCAGGTTCGGG + Intronic
1058406641 9:104684115-104684137 AACCTCTGCCTTCTGGGTTCAGG + Intergenic
1058488520 9:105468574-105468596 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1058590560 9:106560381-106560403 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1058691474 9:107524035-107524057 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1058985485 9:110205973-110205995 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1059091029 9:111358290-111358312 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1059093980 9:111392156-111392178 AACCTCTGCCTCCCTGGTTCAGG - Intronic
1059207494 9:112480365-112480387 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1059351393 9:113667813-113667835 AACCTCTGCCCCCCAGGTTCAGG + Intergenic
1059930470 9:119255411-119255433 ATCATCTGCCCTCCCACCTCTGG - Intronic
1059953156 9:119488740-119488762 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1059977597 9:119734637-119734659 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1060287576 9:122267297-122267319 AACCTATGCCTTCCAGGTTCAGG - Intronic
1060363306 9:122981965-122981987 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1060422832 9:123481875-123481897 AACCTCTGCCTTCCAGGTTCAGG + Intronic
1060659859 9:125398869-125398891 AACCTCTGCCTCCCTGGTTCAGG + Intergenic
1060946646 9:127573552-127573574 AACCCCTGCCCTCACGCTGGAGG + Intronic
1061069735 9:128301850-128301872 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1061129487 9:128700720-128700742 AACCTCTGCCTCCCAGATTCAGG + Intergenic
1061192943 9:129092728-129092750 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1061210722 9:129190999-129191021 AACCTCTGCCTCCCTGGTTCAGG - Intergenic
1061215837 9:129221635-129221657 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1061224113 9:129270668-129270690 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1061351852 9:130071763-130071785 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1061441005 9:130603263-130603285 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1061473848 9:130849598-130849620 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1061481392 9:130899105-130899127 TACCTCTGCCCTCCCTCCTCTGG + Intergenic
1061501546 9:131006087-131006109 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1061991453 9:134161464-134161486 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1062125671 9:134860518-134860540 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1062211843 9:135369080-135369102 AACCTCTGACTTCCAGGTTCAGG + Intergenic
1062490261 9:136801622-136801644 AACCTCTGCCTTCTGGGTTCAGG - Intronic
1062526413 9:136979670-136979692 AACCTCTTCACTTCCGGTTCTGG + Intronic
1062552800 9:137097821-137097843 CACCGCTCCCCTCCAGCTTCGGG - Exonic
1062626284 9:137443943-137443965 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1062714320 9:137998498-137998520 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1185513013 X:677201-677223 AACCTCTGCCTCCCAGCTTCAGG - Intergenic
1185532987 X:836589-836611 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1185757976 X:2667350-2667372 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1186086561 X:5996678-5996700 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1186830148 X:13382113-13382135 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1186840132 X:13477224-13477246 AACCTCTGCCTCCCGGGTTCAGG + Intergenic
1187315414 X:18189116-18189138 AACCTCTGCCTGCCAGGTTCAGG - Intronic
1187374603 X:18740489-18740511 AACCTCTGCCTCCCGGATTCAGG + Intronic
1187418459 X:19113988-19114010 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1187920429 X:24196192-24196214 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1187951292 X:24473516-24473538 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1188854836 X:35181175-35181197 ATCCTCTCCCCCCCAGCTTCTGG + Intergenic
1189118072 X:38364042-38364064 AACCTCTGCCTCCCAGTTTCAGG - Intronic
1189524051 X:41800959-41800981 AACCTCTGATGTCCCTCTTCAGG - Intronic
1189716858 X:43876038-43876060 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1189764519 X:44356795-44356817 AACCTCTGCCTCCCTGGTTCAGG + Intergenic
1189813936 X:44805928-44805950 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1189836417 X:45027873-45027895 AACCTCTGCCTGCCAGGTTCAGG + Intronic
1190031471 X:46977275-46977297 AACCTCTGCCTCCCGGATTCAGG - Intronic
1190273395 X:48884491-48884513 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1190295963 X:49027859-49027881 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1190322351 X:49186522-49186544 GGCCTCTGCCCTCCCGCTCCGGG + Intronic
1190535581 X:51423405-51423427 AAATTTTGCCCTCCCCCTTCAGG + Intergenic
1190784925 X:53636638-53636660 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1190825413 X:54013734-54013756 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1190890202 X:54560988-54561010 AACCTCTGCCTCCCAGGTTCAGG - Exonic
1191997768 X:67114922-67114944 AATCTCCGCCCTCCAGGTTCAGG + Intergenic
1192292240 X:69810174-69810196 AACCTCTGCCTCCCAGGTTCAGG - Intronic
1192305577 X:69956421-69956443 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1192370836 X:70511669-70511691 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1192744912 X:73929324-73929346 AACCTCTACCTCCCCGGTTCAGG - Intergenic
1192783499 X:74316925-74316947 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1193311656 X:80016922-80016944 AACCTCTGCCCCCCAGCTTCAGG - Intronic
1193403358 X:81072175-81072197 AATCTCAGCCCTACAGCTTCAGG - Intergenic
1193414738 X:81208178-81208200 AACCTCTGCCTTCCGGGTTCAGG - Intronic
1193804171 X:85973215-85973237 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1193807671 X:86013651-86013673 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1193880576 X:86916182-86916204 AACCTCTGCCATCCCATTGCTGG - Intergenic
1194244003 X:91487738-91487760 AACCTCTGCCGCCCAGGTTCAGG - Intergenic
1194298632 X:92158132-92158154 AACCTCTGCCTCCCCAGTTCAGG - Intronic
1194536844 X:95116168-95116190 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1194990856 X:100544915-100544937 AACCTCTGCCTTCTGGGTTCAGG + Intergenic
1195209028 X:102633750-102633772 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1195687661 X:107601005-107601027 AACCTCTGGCCTCCCCATGCTGG - Exonic
1196087284 X:111697710-111697732 AACCTCTGCTTTACCACTTCTGG + Intronic
1196689542 X:118544740-118544762 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1196796377 X:119505107-119505129 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1196801391 X:119546357-119546379 AGCCTCTGCCTTCCAGGTTCAGG - Intronic
1196818090 X:119680897-119680919 AACCTCTGCCTCCCGGGTTCAGG - Intronic
1198424735 X:136505708-136505730 AACCTCTGCCTACCGGGTTCAGG - Intronic
1198462522 X:136877248-136877270 AACCTCTGCCTTCCAGGTTCAGG - Intronic
1198467708 X:136918477-136918499 AACCTCCGCCCTCCGCCTCCTGG + Intergenic
1198514359 X:137389710-137389732 AACCTCTGCCTCCCGGGTTCAGG - Intergenic
1198527612 X:137518001-137518023 AACCCCTGCTTTCCCGCTTAAGG - Intergenic
1198745688 X:139888213-139888235 AACCTCTGCCTCCCGGGTTCAGG + Intronic
1198824407 X:140684022-140684044 AACCTCTGCTTTCCAGGTTCAGG - Intergenic
1198943088 X:141980539-141980561 AACCTCTGCCTCCCGGATTCAGG + Intergenic
1199155711 X:144546691-144546713 AACCTCAGCCTTCCGGGTTCAGG + Intergenic
1200088156 X:153621158-153621180 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1200161052 X:154009503-154009525 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1200172378 X:154086742-154086764 AACCTCTGCCTCCCAGGTTCAGG + Intronic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200562983 Y:4729100-4729122 AACCTCTGCCGCCCAGGTTCAGG - Intergenic
1200616247 Y:5383120-5383142 AACCTCTGCCTCCCCAGTTCAGG - Intronic
1200688188 Y:6276610-6276632 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1201012376 Y:9560342-9560364 AACCTCTGCCTCCCAGGTTCAGG - Intergenic
1201047079 Y:9898091-9898113 AACCTCTGCCTCCCAGGTTCAGG + Intergenic
1201299396 Y:12492876-12492898 AACCTCTGCCTCCCTGGTTCAGG + Intergenic
1201317335 Y:12660829-12660851 AACCTCTGCCTCCCTGATTCAGG + Intergenic
1201914157 Y:19164743-19164765 AACCGCTGCCTTCCGGCTTCAGG - Intergenic