ID: 915196774

View in Genome Browser
Species Human (GRCh38)
Location 1:154195399-154195421
Sequence CATTCGCCACAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915196768_915196774 5 Left 915196768 1:154195371-154195393 CCCTCTGAGCCAGAGGAGCTGGT 0: 1
1: 0
2: 2
3: 18
4: 195
Right 915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 172
915196769_915196774 4 Left 915196769 1:154195372-154195394 CCTCTGAGCCAGAGGAGCTGGTT 0: 1
1: 0
2: 1
3: 31
4: 783
Right 915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 172
915196764_915196774 26 Left 915196764 1:154195350-154195372 CCATTTCAAACAGGACTGAGCCC 0: 1
1: 0
2: 4
3: 5
4: 137
Right 915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 172
915196766_915196774 6 Left 915196766 1:154195370-154195392 CCCCTCTGAGCCAGAGGAGCTGG 0: 1
1: 0
2: 3
3: 29
4: 330
Right 915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 172
915196770_915196774 -4 Left 915196770 1:154195380-154195402 CCAGAGGAGCTGGTTATAGCATT 0: 1
1: 0
2: 0
3: 13
4: 96
Right 915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915196774 Original CRISPR CATTCGCCACAGAGGGAAGA GGG Intergenic
900510201 1:3055466-3055488 CATTCCCAACAGTGGGAATACGG + Intergenic
900572893 1:3368103-3368125 CATTCCCAACAGAGGGGAGGAGG + Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
903502879 1:23811462-23811484 GATGTGCCACAGAGGAAAGATGG + Intronic
903836123 1:26204236-26204258 TGTTGGCCAGAGAGGGAAGAAGG + Intergenic
903936745 1:26900598-26900620 CCTTTCCCACAGAGGGAAGCCGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
905774973 1:40662563-40662585 CTTCTGCCACAGAGGCAAGAGGG + Intronic
906048548 1:42851911-42851933 CATTCTCCAAAGTGGGATGAAGG - Exonic
907491458 1:54811444-54811466 CATGAGCCAATGAGGGAAGAAGG + Intronic
909694434 1:78450161-78450183 CATTTGACAGAGAAGGAAGATGG - Intronic
912986806 1:114441715-114441737 CATTTGGCAAAGAGGGCAGATGG - Intronic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
914347892 1:146815470-146815492 CATTCGCCACAGTGTCCAGAGGG + Intergenic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
922739925 1:228009036-228009058 CTTTGGCCACACAGGGAAGCGGG + Intronic
922847177 1:228695854-228695876 CAATCTCCAGGGAGGGAAGAGGG - Intergenic
922905420 1:229170275-229170297 CATCCGCCACAGAAAGAAGGTGG + Intergenic
923038277 1:230300793-230300815 CATTCCCCAGAGATGGAAGCAGG + Intergenic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
923703298 1:236320379-236320401 TACTAGCCACAGAGTGAAGATGG - Intergenic
1062999871 10:1906324-1906346 CATGTGGCACAGAAGGAAGATGG + Intergenic
1062999885 10:1906425-1906447 CATGTGGCACAGAAGGAAGATGG + Intergenic
1067395903 10:45917112-45917134 CATTGGTCACATAGGGAAGTAGG - Intergenic
1067543547 10:47175474-47175496 CCTTCCCCACTGTGGGAAGAGGG + Intergenic
1067864227 10:49886237-49886259 CATTGGTCACATAGGGAAGTAGG - Intronic
1069234288 10:66050704-66050726 CATTCCCCAGAGAAGGAATATGG - Intronic
1069464044 10:68622265-68622287 CCTTGTCCAAAGAGGGAAGAGGG - Intronic
1070814970 10:79317275-79317297 GACTGTCCACAGAGGGAAGAAGG + Intergenic
1074458657 10:113616919-113616941 CCTTTCCCACAGAGGGAAAAGGG + Intronic
1076477876 10:130765223-130765245 CATTTGACACAGACAGAAGAGGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081587642 11:44398324-44398346 CCCCCGGCACAGAGGGAAGAGGG - Intergenic
1083304948 11:61757261-61757283 CATTCGCCAGCGAGGGCAGCTGG + Intronic
1083550175 11:63582359-63582381 CAACCAGCACAGAGGGAAGAAGG + Intronic
1084279060 11:68074665-68074687 CATATGCCACAGACAGAAGATGG - Intronic
1084607563 11:70181311-70181333 CAGTCCCCACAGAGGGCAGGGGG + Intronic
1089474859 11:118751153-118751175 GCTTTGCCACAGAGGAAAGAGGG + Exonic
1091287517 11:134415987-134416009 CCTCAGCCACAGAGGAAAGAAGG - Intergenic
1091759334 12:3077054-3077076 CGTTCGCCGCAGGGGGAAGGCGG + Intergenic
1094097824 12:26727886-26727908 CATTCAGCACAGGGGCAAGAGGG + Intronic
1094348645 12:29498780-29498802 CACTAGCCACAGAGGGTAAATGG - Intergenic
1096425309 12:51496603-51496625 CATTCCTCACAGTGGGATGATGG - Intronic
1097719388 12:63003445-63003467 CACCCGCCACAGAGGGCTGAAGG + Intergenic
1098535069 12:71584698-71584720 CAAATGCCACAGAGGAAAGATGG - Exonic
1101721102 12:107351413-107351435 CATCCGCCACAGCAGGCAGAAGG - Intronic
1102171093 12:110843029-110843051 AATCCGCCACAGAAGGAAGGAGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1106631023 13:31473679-31473701 CAATCTCCAGGGAGGGAAGAAGG + Intergenic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107484228 13:40810964-40810986 CAATCACCAAACAGGGAAGAAGG - Intergenic
1113125273 13:106971411-106971433 AATGGGCCACAGATGGAAGATGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116936681 14:50747706-50747728 CCTAGGCAACAGAGGGAAGAAGG + Intronic
1116984735 14:51206517-51206539 CATCCTTCAGAGAGGGAAGAGGG - Intergenic
1117162921 14:53006807-53006829 CACTCGCAAAAGAGGGGAGAAGG + Intergenic
1118438088 14:65789570-65789592 CCTTCGCCCCAGAGTGAGGAAGG - Intergenic
1119848394 14:77847659-77847681 CACTGGCCACAGTGGGAAAAGGG - Intronic
1121506911 14:94484533-94484555 CATGGGCCACAGAGGGATGCTGG - Intergenic
1121603178 14:95221172-95221194 CATTCTTCACAGAGGGGAGGGGG - Intronic
1122076183 14:99236449-99236471 GGTTTGCTACAGAGGGAAGATGG + Intronic
1123772425 15:23541626-23541648 CATTCTCCAGGGAGGCAAGAGGG - Intergenic
1125020652 15:34983018-34983040 CTTTTACCACAGAGGAAAGATGG - Exonic
1125815416 15:42580162-42580184 CATTCCTCCCAGAGGAAAGAAGG + Intronic
1126136502 15:45397374-45397396 CATTCTCCAGAGAGGGACGGAGG + Intronic
1128221215 15:65969983-65970005 CATGTGCCACAGCGGGAAGAAGG - Intronic
1130733451 15:86523327-86523349 ACTTGGACACAGAGGGAAGATGG - Intronic
1132071850 15:98785359-98785381 CATATGCTACAAAGGGAAGAGGG - Intronic
1133536315 16:6705546-6705568 CATTCTCCAAAAAGGGAAGAAGG + Intronic
1134366838 16:13586665-13586687 TATTCCCCAGAGAGGAAAGAAGG - Intergenic
1138599429 16:58046102-58046124 CTTTCTCCAGAGAGGGAAGGAGG - Exonic
1139986143 16:70900062-70900084 CATTCGCCACAGTGTCCAGAGGG - Intronic
1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG + Exonic
1141250349 16:82350836-82350858 CATTAGCCACAGATGCATGAGGG + Intergenic
1146397482 17:32480316-32480338 CATTCTCATCACAGGGAAGAGGG - Intronic
1148092744 17:45032406-45032428 TATTGGCCACAGGGGGATGAGGG + Intronic
1149548449 17:57521899-57521921 CATTCTCCAAAGAGGAAGGACGG - Intronic
1150288773 17:63969503-63969525 CATTGGCCACTGAGCCAAGACGG - Intronic
1155357749 18:24969749-24969771 TATTTCCCACAGAGGGAAGGAGG + Intergenic
1155987576 18:32246295-32246317 CATTCGGAAAAGAGGGAAAATGG - Intronic
1162956880 19:14103679-14103701 CATTAGCCACAGGGGGATGCTGG + Intronic
1163977862 19:20869484-20869506 CATTCACCCCAGTGGGAACATGG + Intergenic
1163982013 19:20909708-20909730 CATTCACCACAGTGAGAACATGG + Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
925946142 2:8865656-8865678 CATTCCCCGTAAAGGGAAGAGGG - Intronic
926714857 2:15916205-15916227 CATTTGTCTCAGAGGGAAAATGG + Intergenic
928178834 2:29053365-29053387 CACCTGCCACAGAGGCAAGATGG - Exonic
931244917 2:60484469-60484491 CATTCACCAGAAAGGGAAGTAGG + Intronic
933455952 2:82519425-82519447 TATTTGACACAGAGGAAAGAAGG - Intergenic
934515632 2:94984846-94984868 CATTGCCCACAGAGGGAACCCGG - Intergenic
935882819 2:107583400-107583422 CATGTGCTACAGAGGCAAGAAGG + Intergenic
936051709 2:109228902-109228924 CATCCTCCAAAGAGGGCAGAGGG - Intronic
942695755 2:178642736-178642758 TCTTCTCCACTGAGGGAAGAAGG + Intronic
943637237 2:190319651-190319673 CACTCGCCACAGTGGGAAAAGGG - Intronic
944538679 2:200736483-200736505 TATTTGACACAGAGGGAAAAGGG - Intergenic
944834962 2:203570233-203570255 CATTTGCCAAAGTGAGAAGATGG - Intergenic
948353283 2:237358143-237358165 CCTTGGCCACAGAGGCAGGATGG + Intronic
1169132352 20:3172897-3172919 CTTAGGCCACCGAGGGAAGACGG - Intronic
1169179471 20:3550783-3550805 CTTTCCCCCCAGAGGGAAGGGGG - Intronic
1171865674 20:30486046-30486068 CATGCGCCACAGGGGGAACACGG + Intergenic
1172787320 20:37477742-37477764 CATACTCCACAGAGCTAAGAAGG - Intergenic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1174545831 20:51324457-51324479 CATTCAACATAGAGGGGAGATGG + Intergenic
1175846215 20:62060227-62060249 CATTTGCCACAGAAGCAAGCGGG + Intronic
1177707995 21:24734184-24734206 GATTTGCCACAGAAGTAAGAGGG + Intergenic
1181998974 22:26904589-26904611 AATTCTCCACTGAGGGAAGCAGG + Intergenic
1183005710 22:34900002-34900024 CACTGGCCACAGATGGATGAGGG - Intergenic
1184422810 22:44391651-44391673 AAATCCCCACAGAGGGCAGAGGG - Intergenic
1184726504 22:46350375-46350397 TAATCCCCCCAGAGGGAAGATGG - Exonic
1184994639 22:48196578-48196600 CATTAGCCAGAGAGGGGAAAGGG + Intergenic
950897843 3:16469612-16469634 CGTGCTCCACAGAGGGAAGGGGG + Intronic
953896588 3:46807887-46807909 CATTCCCCGCAGATGGAACATGG + Intronic
954916205 3:54150425-54150447 CCTTCTCCAGAGAGGGAAGGGGG - Intronic
956479458 3:69659503-69659525 CATTCCGCACAGAGGCAACATGG - Intergenic
959346029 3:105195678-105195700 AATTCTCCACAGAGAGAAAAGGG - Intergenic
959673223 3:109002929-109002951 CATTTGCTAAAGAGGGAATATGG - Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
963177682 3:142317638-142317660 GCTGCGTCACAGAGGGAAGACGG + Intronic
966332034 3:178825335-178825357 CATTGGCCCCAGAGTAAAGAAGG + Intronic
966716574 3:183018727-183018749 TCTTCCCCAGAGAGGGAAGAGGG + Intronic
967106410 3:186258168-186258190 CATTCGACACAAATGGAAAATGG + Intronic
968137323 3:196228541-196228563 CATTCACCAAAGTGGGCAGAAGG - Intronic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
972736263 4:41844607-41844629 GATTCCAGACAGAGGGAAGAAGG - Intergenic
973083255 4:46022172-46022194 CATTTTCCAGAGATGGAAGAAGG - Intergenic
976372924 4:84310956-84310978 TATTCACCACAAAGTGAAGAGGG + Intergenic
977721415 4:100244174-100244196 CAACCCCCAGAGAGGGAAGAGGG + Intergenic
977773461 4:100888349-100888371 CATAGGCCACAGAGGGAAACTGG + Intergenic
978232133 4:106412446-106412468 CCTTCTCCAGAGAGGGGAGAGGG - Intergenic
980381485 4:132025464-132025486 CATGCACCACAGAGGAAAAATGG + Intergenic
982373487 4:154660242-154660264 CATGCTCAACAGAGGGAACAAGG + Intronic
982471884 4:155802357-155802379 CATTGGCAACAGACGGAGGAAGG - Exonic
983616213 4:169708164-169708186 CAATGGCCACAGAGGTAAGCTGG - Intronic
987806604 5:22777238-22777260 CACTCACCATAGAAGGAAGAGGG - Intronic
988589685 5:32538063-32538085 GAGAAGCCACAGAGGGAAGAAGG - Intronic
993901378 5:93585776-93585798 CATCCAAGACAGAGGGAAGAAGG - Intronic
994878474 5:105455600-105455622 CATCCGGCACAGGGGAAAGATGG + Intergenic
996042323 5:118829088-118829110 CATTCCCCACTGAATGAAGAAGG - Intergenic
996220420 5:120925131-120925153 GATTCTTCACAGAGGGAAGGGGG + Intergenic
997515958 5:134490130-134490152 CAAGGGCCACAGAGGGAAAACGG - Intergenic
999600263 5:153254683-153254705 TATTGGCCACAGCGAGAAGATGG - Intergenic
1001408695 5:171495263-171495285 CATGCCCCACAGAGGAAGGAAGG + Intergenic
1001542687 5:172550476-172550498 CCCTCCCCACAGAGGCAAGATGG - Intergenic
1002160750 5:177312614-177312636 CATTCGACACAGTAGGAAGCTGG - Intronic
1004507273 6:16257105-16257127 CATTTTCCAGAGAGGGGAGAGGG + Intronic
1006889932 6:37418124-37418146 CATGGCCCACAGAGAGAAGATGG - Intergenic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1010745666 6:79558787-79558809 CATTCCCCACAGAAGGAATCAGG + Intergenic
1015681207 6:135810706-135810728 AATGCCCCTCAGAGGGAAGAAGG + Intergenic
1016821339 6:148349075-148349097 CCTTCCCCACAGAGCAAAGAGGG + Intronic
1016943918 6:149510290-149510312 AGTTACCCACAGAGGGAAGAAGG + Intronic
1017729209 6:157300212-157300234 CACTCGCCACAGAGGGCTGAAGG - Intronic
1018988679 6:168657107-168657129 CACTCACCACTGTGGGAAGAGGG + Intronic
1019699647 7:2468454-2468476 CATTGGCCACAGAGAGAGGCAGG + Intergenic
1020670535 7:11102862-11102884 CATTTGCCAAAGAAGCAAGAGGG - Exonic
1022905212 7:34849142-34849164 CATAAGCCACAGAGGGTAGGTGG + Intronic
1027142398 7:75668225-75668247 CCCTCGCCACTGAGGCAAGAGGG - Intronic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1035279308 7:157767226-157767248 CATAAGCCACAGATGGATGATGG - Intronic
1036617235 8:10397927-10397949 CATTAACAAGAGAGGGAAGAGGG - Intronic
1036678563 8:10853964-10853986 CATTTACCACAGAGAAAAGAGGG + Intergenic
1037501434 8:19489456-19489478 GATTGGCCTCAGAAGGAAGAAGG - Intronic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1041437709 8:57860812-57860834 CATTCTCCAGAGATGCAAGAGGG - Intergenic
1042051614 8:64715646-64715668 CACTGGCAACAGAGGGAAAATGG + Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1047255631 8:123211559-123211581 CACACGCTACAGAGGAAAGAAGG - Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1052295578 9:26893379-26893401 CTTTAGCCACTGAGGGAAAAAGG + Intergenic
1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG + Intronic
1061079710 9:128362511-128362533 AGTTCTCCACAGTGGGAAGAAGG + Intergenic
1187285343 X:17898827-17898849 CAATCACCACAGAGTCAAGAAGG - Intergenic
1195284849 X:103374705-103374727 CATTCGCACCAAAGGGTAGATGG + Intergenic
1195742755 X:108081954-108081976 CATCCTCCAGGGAGGGAAGAGGG - Intergenic
1197675094 X:129321098-129321120 GATTCCCCACAGATGCAAGAAGG - Intergenic
1198427162 X:136531750-136531772 CATTGGCCAAAGAGGGAGAAAGG - Intergenic
1200231743 X:154447180-154447202 CATTCGCCAGAGAGGCAGGAGGG + Intronic